دوره 25، شماره 2 - ( تابستان 1397 )                   جلد 25 شماره 2 صفحات 104-113 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Moradi M, Shabkhiz F, Khalafi M, Talebi V. The acute effect of aerobic exercise on hypothalamic nesfatin-1 gene expression in diabetic male rats with Streptozotocin. J Birjand Univ Med Sci.. 2018; 25 (2) :104-113
URL: http://journal.bums.ac.ir/article-1-2344-fa.html
مرادی محمد، شب خیز فاطمه، خلفی موسی، طالبی وحید. تأثیر فعالیت ورزشی هوازی حاد بر بیان ژن هیپوتالاموسی نسفاتین-1 در رت‌های نر دیابتی‌شده به روش استرپتوزوتوسین. مجله علمي دانشگاه علوم پزشكي بيرجند. 1397; 25 (2) :104-113

URL: http://journal.bums.ac.ir/article-1-2344-fa.html


1- گروه فیزیولوژی ورزشی، دانشکده تربیت بدنی، دانشگاه تهران، تهران، ایران ، m.moradi13@ut.ac.ir
2- گروه فیزیولوژی ورزشی، دانشکده تربیت بدنی، دانشگاه گیلان، رشت، ایران
3- گروه فیزیولوژی ورزشی، دانشکده علوم ورزشی، دانشگاه مازندران، بابلسر، ایران
واژه‌های کلیدی: نسفاتین-1، تمرین تداومی، رت دیابتی
متن کامل [PDF 442 kb]   (564 دریافت)     |   چکیده (HTML)  (2654 مشاهده)
متن کامل:   (124 مشاهده)
Abstract                                                                                                                                                                        Original Article

The acute effect of aerobic exercise on hypothalamic nesfatin-1 gene expression in diabetic male rats with STZ

 Mohammad Moradi[1], Fatemah Shabkhiz1, Moosa Khalafi[2], Vahid Talebi[3]
 
Background and Aim: Nesfetin-1 is known as the Neuropeptide which interferes with appetite and glucose hemostasis.  It has been reported its amount in healthful persons than diabetes sick is variable and changes according to the exercise. The aim of the present study is to investigate the effects of acute aerobic exercise on nesfatin-1 gene expression in diabetic rats.
Materials and Methods: In this experimental study, has utilized the diabetic Wistar rat'sstagy rats with STZ (12 week-age, 220-240 gr-weight). Animals were divided into 4 groups: continuous exercise (COE-0) and control (CO), (Immediately after exercise were killed) and continuous (COE-2) and control (C-2), (Two hours after the exercise, they were killed), respectively. Group COE performed exercise at a speed of 18 meters per minute, equivalent to 65% of maximum speed, for 40 minutes on the treadmill. Hypothalamus tissue was excised for determination of nesfatin-1 gene expression by RT-PCR methods. Data were analyzed using SPSS software (version 20) with independent T-test (P <0.01).
Results: The current results indicated that the levels of nesfatin-1 gene expression, increased significantly in training group immediately and two hours after exercise when compared with Control group yourself.
Conclusion: It seems a session of continuous exercise may increase the hypothalamic expression of male Wistar rats with diabetes nesfatin -1 immediately and two hours after the exercise.
Key Words: Nesfatin-1, Continuous exercise, Diabetics rat
Journal of Birjand University of Medical Sciences. 2018; 25(2): 104-113.
Received: May 12, 2018                  Accepted: April 23, 2018       
 

مقاله اصیل پژوهشی

تأثیر فعالیت ورزشی هوازی حاد بر بیان ژن هیپوتالاموسی نسفاتین-1
 در رت‌های نر دیابتی‌شده به روش
STZ

محمد مرادی[4]، فاطمه شب‌خیز1، موسی خلفی[5]، وحید طالبی[6]
 
چکیده
زمینه و هدف: نسفاتین-1 به‌عنوان نوروپپتیدی که در اشتها و هموستاز گلوکز دخالت دارد، شناخته شده است. گزارش شده است که مقادیر پایه آن در بیماران دیابتی نسبت به افراد سالم متغیر بوده و با تمرین ورزشی دستخوش تغییر می‌شود. هدف پژوهش حاضر، بررسی تأثیر فعالیت ورزشی حاد هوازی بر بیان ژن نسفاتین-1 در رت‌های دیابتی بود.
روش تحقیق: در این مطالعه تجربی، رت‌های نر ویستار دیابتی‌شده با STZ (12هفته سن و با وزن 240-220 گرم) به کار برده شدند. حیوانات به 4 گروه تمرین تداومی (COE-0) و کنترل (C-O)(که بلافاصله پس از تمرین کشته شدند) و تداومی (COE-2) و کنترل (C-2)(که دو ساعت پس از تمرین کشته شدند)، تقسیم شدند. گروه COE با سرعت 18متر در دقیقه که معادل 65درصد حداکثر سرعت بود، به‌مدت 40دقیقه به فعالیت روی تردمیل پرداختند. بافت هیپوتالاموس برای تعیین بیان ژن نسفاتین-1 به روش RT.PCR جدا گردید. داده‌ها با استفاده از نرم‌افزار SPSS (ویرایش 20) و با کمک آزمون تی‌مستقل در سطح 01/0P< تجزیه و تحلیل شد.
یافته‌ها: نتایج نشان داد که میزان بیان ژن نسفاتین-1 در گروه تمرین در مرحله بلافاصله و دو ساعت بعد از تمرین، نسبت به گروه کنترل خود افزایش معنی‌داری داشت.
نتیجه‌گیری: به نظر می‌رسد یک جلسه فعالیت تداومی می‌تواند موجب افزایش بیان هیپوتالاموسی نسفاتین-1 رت‌های نر ویستار دیابتی بلافاصله و دو ساعت پس از تمرین شود.
واژه‌های کلیدی: : نسفاتین-1، تمرین تداومی، رت دیابتی
مجله علمی دانشگاه علوم پزشکی بیرجند. 1397؛ 25(2): 104-113.
 دریافت:  22/7/1396     پذیرش:  3/2/1397
 
مقدمه
سیستم غدد درون‌ریز، در تولید و تخلیه هورمون‌های تنظیم‌کننده عملکرد بدن نقش مهمی بر عهده دارند. در این میان، هیپوتالاموس غدّه حیاتی در مغز است که نقش اصلی در کنترل مصرف غذا دارد و یک منبع غنی از پپتیدهای تنظیم‌کننده سیری است که در تعادل بلندمدّت انرژی شرکت می‌کند (1). بیشتر نروپپتیدهای هیپوتالاموسی و نیز انتقال‌دهنده‌های عصبی تنظیم اشتها، بر سوخت و ساز محیطی گلوکز نیز تأثیر می‌گذارند. نسفاتین-1[7]، پپتیدی با 82 اسیدآمینه است که از فرآیند پس‌ترجمه‌ای نوکلئوبایندین-2[8] (NUCB2) مشتق شده و توسط Oh و همکاران گزارش شده است (2). پروتئین NUCB2 به سه قطعه تجزیه می‌شود: نسفاتین-1، نسفاتین-2 و نسفاتین-3. نسفاتین-1، وزن مولکولی معادل 8/9کیلودالتون و نیمه عمر mRNA دارد؛ نوکلئوبایندین-2 نیز نیمه عمری تقریباً 6ساعت دارد. دیگر بخش‌های نسفاتین که از NUCB2 مشتق می‌شوند (نسفاتین-2 و نسفاتین-3)، فعالیت ضدّ اشتهایی ندارند. بخش‌های مختلف mRNA نسفاتین شامل: پایانه N ترمینال مشترک بین نسفاتین 1 و 2 (شامل 1-82 اسید آمینه) و دو سی ترمینال مختلف می‌باشد که برای نسفاتین-2 «85-163a.a» و نسفاتین-3 «166-396a.a» است. بخش میانی نسفاتین-1 (M30)، مسئول محدودیت مصرف غذا است؛ در حالی‌که نقش فیزیولوژیکی دقیق نسفاتین-2 و نسفاتین-3 هنوز شناخته شده نیست. سطح نسفاتین-1 در مایعات بیولوژیکی در برخی شرایط پاتولوژیکی کاهش، افزایش و یا عدم تغییر را نشان می‌دهد (3).
نسفاتین-1 که جدید کشف شده است، توسط گرسنگی و سیری تنظیم می‌شود (4) و بیان آن در بسیاری از اندام‌ها و بافت‌ها صورت می‌گیرد (4، 5). نشان داده شده است که میانگین سطوح پلاسمایی ناشتای نسفاتین-1، اندکی اما نه به‌طور معنی‌دار، در بیماران دیابتی نوع اول[9] (T1DM) در مقایسه با افراد سالم بالاتر است. با این وجود، سطح ناشتای نسفاتین-1، به‌طور معنی‌داری در بیماران دیابتی نوع دوم[10] (T2DM) در مقایسه با افراد سالم و بیماران T1DM پایین‌تر است. توضیح احتمالی این است که کاهش معنی‌دار سطح پلاسمایی ناشتای نسفاتین-1 در بیماران T2DM شاید با اختلال حساسیت انسولینی مرتبط باشد (6). مطالعه جدیدی توسط Gonzalez و همکاران نشان داد که انسولین تولیدشده در سلول‌های بتا، پری‌پرونسفاتین را در جزایر موش‌ها و رت‌ها به شکل مرکزی و موضعی تولید می‌کند که نشانگر نقش بالقوّه پپتیدهای مشتق‌شده از پری‌پرونسفاتین در رهایی انسولین و متابولیسم گلوکز است (7).
نتایج به‌دست آمده از تأثیر فعالیت بدنی بر تغییرات نسفاتین-1، متضاد و البته انگشت شمار بوده‌اند. به‌عنوان نمونه، در مطالعه‌ای توسط قنبری نیاکی و همکاران، تغییرات بیان ژن و پلاسمایی نسفاتین-1 به‌دنبال 8 هفته تمرینات هوازی روی رت‌های ماده بررسی شد. در این مطالعه، 20 رت ویستار مادّه در دو گروه کنترل و تمرین به‌کار گرفته شدند. پروتکل تمرینی شامل 8هفته دویدن روی تردمیل بود. نتایج این مطالعه افزایش معنی‌دار نسفاتین-1 کبد، روده کوچک، کلیه و پلاسما ناشی از تمرینات هوازی را نشان داد (8). اگرچه تحقیقاتی هر چند اندک در رابطه با تأثیر فعالیت ورزشی بر تغییرات نسفاتین-1 صورت گرفته است، اما به نظر می‌رسد هنوز مجهولات فراوانی در این مورد وجود دارد؛ بنابراین مطالعه حاضر در نظر داشت تا اثر یک جلسه فعالیت ورزشی را بر بیان ژن نسفاتین-1 در رت‌های نر دیابتی، مورد بررسی قرار دهد.
 
روش تحقیق
روش پژوهش حاضر از نوع تجربی و با طرح پس‌آزمون با گروه کنترل می‌باشد. تعداد 28 سر رت نر نژاد ویستار 8هفته‌ای در محدوده وزنی 150 تا 180 گرم، از مؤسّسه تکثیر و پرورش حیوانات آزمایشگاهی انیستیتو پاستور ایران خریداری شده و به آزمایشگاه حیوانات دانشکده تربیت بدنی و علوم ورزشی دانشگاه تهران منتقل گردیدند. حیوانات برای سازگاری با محیط و رسیدن به دامنه وزنی مطلوب، در آزمایشگاه در قفس‌های 4تایی از جنس پلی‌کربنات، در چرخه روشنایی و تاریکی 12 ساعت نور و 12 ساعت تاریکی (از 7 شب تا 7 صبح)، رطوبت نسبی50 تا 60 درصد و درجه حرارت 2±22درجه سانتی‌گراد نگهداری شدند. در این مدت رت‌ها آزادانه به غذا و آب دسترسی داشتند. پس از دو هفته، تعداد 6رت با دامنه وزنی بالاتر ( 185 تا 200 گرم) به‌عنوان گروه آزمایشی (پایلوت)[11] انتخاب شده و با تزریق داروی استرپتوزوتوسین (STZ)[12]، دیابت در آنها القا شد. از این رت‌ها برای بررسی‌های مقدماتی و بررسی قابلیت انجام پروتکل تمرینی استفاده شد.
القای دیابت:
دیابت، با تزریق تک‌دوز داروی STZ حل‌شده در بافر 1/0 مولار سیترات‌‌سدیم با PH 5/4، به‌مقدار 50 میلی‌گرم به‌ازای هر کیلوگرم وزن بدن (داخل صفاقی IP)[13] القا شد. طبق این روش 48 ساعت پس از تزریق، دیابت در رت‌ها القا می‌شود. برای تأیید دیابت، 4 روز پس از تزریق STZ با ایجاد جراحت کوچک در دم حیوانات یک قطره خون بر روی نوار گلوکومتری قرار گرفته و توسط دستگاه گلوکومتر خوانده شد. قند خون بالای 300 میلی‌گرم در دسی‌لیتر، به‌عنوان شاخص دیابتی‌شدن در نظر گرفته شد (9).
پروتکل ورزشی:
روز اجرای آزمون ورزشی، رت‌ها براساس وزن و گلوکز خون همگن شدند و به این شرح در گروه‌های مختلف جای گرفتند: گروه کنترل دیابتی (5 سر)؛ گروه کنترل دیابتی که دو ساعت بعد کشته شدند (5 سر)؛ گروه تمرین تداومی که بلافاصله پس از اجرای تمرین کشته شدند (6 سر) و گروه تمرین تداومی که دو ساعت بعد از اجرای تمرین کشته شدند (6 سر). برنامه تمرین تداومی (COE)در جدول یک بیان شده است.
آزمودنی‌ها قبل از روز تمرین، در سه روز غیر متوالی برای آشنایی با محیط تردمیل و نحوه دویدن، با سرعت‌های متغیّر بر روی نوار گردان به اجرای فعالیت پرداختند. 3 تا 4 جلسه در هفته (روزانه به‌مدّت 5 تا 10 دقیقه با سرعت پایین 10 تا 15 متر در دقیقه در شیب صفر درجه) برای راه‌رفتن و دویدن حیوانات در نظر گرفته شد. در انتهای نوار گردان، یک شوک الکتریکی برای تحریک و وادارکردن آزمودنی‌ها به ادامه اجرای برنامه تمرینی، تعبیه شده بود. برای کاهش اثرات احتمالی شوک الکتریکی بر نتایج تحقیق حاضر، سعی شد با شرطی‌کردن حیوانات نسبت به صدا، از استراحت آنها در بخش انتهایی نوار گردان جلوگیری شود. در روز آزمون، حیوانات دو ساعت قبل از اجرای فعالیت ورزشی، فقط از دسترسی به غذا و نه آب، منع شدند.
جمع‌آوری نمونه‌ها:
6سر رت از گروه تمرین تداومی (COE) پس از تمرین و همچنین 6سر رت دیگر نیز دو ساعت پس از اتمام تمرین، نمونه‌برداری شدند؛ همچنین 5سر رت از گروه کنترل بلافاصله پس از قرارگیری بر روی نوارگردان و 5سر رت دیگر 2ساعت پس از قرارگیری بر روی نوارگردان، همانند گروه‌های تمرین نمونه‌برداری شدند. برای مشابه‌سازی هر چه بیشتر شرایط، گروه‌های کنترل نیز همزمان با گروه‌های تمرینی به‌طور ساکن بر روی تردمیل قرار گرفتند. برای جمع‌آوری نمونه‌ها ابتدا حیوان با ترکیبی از داروی زایلازین (10 میلی‌گرم/کیلوگرم) و کتامین (75 میلی‌گرم/کیلوگرم) به‌صورت تزریق درون صفاقی بیهوش شد. پس از اطمینان از بیهوش‌شدن حیوانات، قفسه سینه حیوان شکافته ‌شد و برای
 
جدول 1- پروتکل فعالیت ورزشی تداومی
گرم کردن بدنه اصلی تمرین شدت اجرای فعالیت سرد کردن زمان کل فعالیت
5 دقیقه 40 دقیقه با 65 درصد حداکثر سرعت 5 دقیقه 50 دقیقه
(8 متر در دقیقه) (18 متر در دقیقه) (8 متر در دقیقه)
جدول 2- پرایمرهای طراحی‌شده در این مطالعه
نام ژن   توالی پرایمرها
Nesfatin F 5̕̕ˈTTTGAACACCTGAACCACCA3ˈ
R 5' TGCAAACTTGGCTTCTTCCT 3'
βActin F 5' CACCCGCGAGTACAACCTTC 3'
R 5' CCCATACCCACCATCACACC 3'
 
 
 
 
 
 
اطمینان از کمترین آزار حیوان، خون‌گیری به‌طور مستقیم از قلب حیوان به‌عمل آمد؛ سپس هیپوتالاموس از بدن حیوان جدا و در سرم فیزیولوژیک شست و شو داده شد و بلافاصله با استفاده از ازت مایع، منجمد و برای سنجش‌های بعدی به فریزر با دمای 80- منتقل گردید. کیت‌های مورد استفاده در این پژوهش شامل: TryzolRiboEx، کیت cDNA سنتتاز ژن Thermo، پرایمرهای مربوط به ژن نسفاتین-1 و کیت Real time PCR (SYBER Green) بود. از ژن βActin نیز به‌عنوان ژن Housekeeping استفاده شد (جدول 2). برای کمّی‌سازی مقادیر بیان ژن مورد نظر از فرمول
2-∆∆ct  (2 به توان منفی∆∆ct ) استفاده شد.
تجزیه و تحلیل آماری:

نرمال‌بودن توزیع نسفاتین-1 هیپوتالاموسی، با استفاده از آزمون آماری کلوموگروف- اسمیرنوف تعیین گردید. از آزمون تی‌مستقل برای بررسی تأثیر تمرین در بین دو گروه استفاده شد. در همه آزمون‌ها مقدار خطا در سطح 01/0P< محاسبه شد. تمام محاسبات آماری با استفاده از برنامه آماری SPSS (ویرایش 20) انجام گرفت. این مقاله دارای کد اخلاق به شماره IR.SSR.REC.1396.206 می‌باشد.
یافته‌ها
تحلیل دادههای مربوط به بیان ژن در هیپوتالاموس نمونه‌ها نشان داد که بین گروه کنترل (C-0)(0±1) و تمرین تداومی (COE-0)(11/0±29/2)، تفاوت معنی‌داری وجود داشت (001/0P=، 449/5T=)(نمودار 1)؛ همچنین اجرای یک جلسه تمرین تداومی باعث افزایش معنی‌دار بیان ژن نسفاتین-1 در رت‌های نر دیابتی، 2ساعت پس از تمرین شد (04/0±13/1)(001/0P=، 318/6T=)(نمودار 2).
 
نمودار 1- تغییرات نسفاتین -1، بلافاصله پس از تمرین (COE-0). *: تفاوت معنی‌دار نسبت به گروه C-0 (001/0P=).


نمودار 2- تغییرات نسفاتین -1دو ساعت پس از تمرین (COE-2). *: تفاوت معنی‌دار نسبت به گروه C-0 (001/0P=).
 
 
بحث
نتایج پژوهش حاضر نشان داد که یک جلسه فعالیت ورزشی تداومی، موجب افزایش بیان ژن نسفاتین-1 هیپوتالاموسی بلافاصله پس از اجرای پروتکل ورزشی در رت‌های نر دیابتی شد (نمودار 1). همچنین تغییرات بیان ژن هیپوتالاموسی نسفاتین-1 در گروه تمرینی دو ساعت بعد نسبت به گروه کنترل نیز افزایش معنی‌داری داشت (نمودار 2).
حدود 7درصد جمعیت دنیا به بیماری دیابت مبتلا هستند. در ایران این نسبت در سال 86 حدود 7/7درصد بین افراد 25 تا 65 ساله گزارش شده است. سودمندی اثرات فعالیت ورزشی منظم بر شاخص‌های متابولیکی به‌وسیله پژوهش‌های بسیاری تأیید شده است (10). با این وجود، هنوز نکات ناشناخته زیادی در رابطه با تأثیر ورزش بر اشتها، سیری و حساسیّت انسولینی در بیماران دیابتی وجود دارد. دیابت یک بیماری مزمن در مورد عدم توانایی بدن در تولید انسولین کافی و یا استفاده از انسولینی است که تولید می‌کند (11). ارزیابی کلی داده‌ها نشان می‌دهد که اثر ضدّ هایپرگلیسمی نسفاتین ـ1 نه‌فقط از عملکرد اندوکرینی آن بلکه از سرکوب تولید کبدی گلوکز از طریق تنظیم سنتز گلیکوژن و گلوکونئوژنز نیز ناشی می‌شود. مجموع این یافته‌ها نشان می‌دهد که نسفاتین ـ1 موجب تحریک پیام انسولین کبدی می‌شود که می‌تواند مسئول افزایش حساسیّت انسولینی و بهبود سوخت و ساز گلوکز باشد (12).
مطالعه‌ای که توسط بشیری و همکاران روی تأثیر یک جلسه فعالیت هوازی بر سطوح نسفاتین-1 سرمی مردان سالمند غیر ورزشکار انجام گرفت و شامل 30دقیقه فعالیت روی چرخ کارسنج بود، افزایش نسفاتین-1 پس از تمرین را گزارش کرد؛ اگر چه این افزایش معنی‌دار نبود (13). ساز و کار و دلیل پیشنهادی برای این افزایش غیرمعنی‌دار، کم‌بودن هزینه انرژی 30دقیقه فعالیت با چرخ کارسنج اعلام شد. این محققان افزایش زمان تمرین را به‌عنوان عاملی مؤثّرتر در بیان ژن نسفاتین-1 دانستند. پروتکل تمرین تداومی ما در این کار، 50دقیقه طول کشید که موجب بیان معنی‌دار ژن نسفاتین-1 و افزایش حدود 23درصدی بلافاصله پس از فعالیت و افزایش 12درصدی در دو ساعت بعد شد. به‌نظر می‌رسد همانگونه که در پیش از این بیان شد، زمان تمرین، عامل این افزایش باشد.
قنبری نیاکی و همکاران، 8هفته تمرین استقامتی بر روی رت‌های ویستار را مورد مطالعه قرار داده و نشان دادند که مقدار بیان نسفاتین-۱ هیپوتالاموس در رت‌های تمرین‌کرده پایین‌تر بود، اما این تغییرات به حدّ معنی‌داری نرسید. این پژوهشگران اشاره کردند که شاید برداشت غذا (نه آب) از قفس حیوانات ۴ساعت قبل از نمونه‌برداری، موجب کاهش بیان نسفاتین-1 شده است و تأکید کردند احتمالاً تأثیر شدّت فعالیت و دوره‌های برگشت به حالت اولیه پس از تمرین بر بیان و غلظت نسفاتین-1 در بافت‌های متفاوت، متغیّر می‌باشد (14). همین محقق در مطالعه دیگری تأثیر 8هفته تمرین استقامتی روی بیان نسفاتین-1 را در رت‌های ماده بررسی کرد. نتایج این تحقیق، افزایش معنی‌دار نسفاتین-1 کبد، روده کوچک، کلیه و پلاسما ناشی از تمرینات هوازی را نشان داد. به‌طور مجدد اشاره گردید که اگر چه مکانیسم تأثیر تمرین استقامتی روی نسفاتین شناخته شده نیست؛ اما گرسنگی و تغذیه روی سطوح آن تأثیر دارد (15). این نتایج همسو با تحقیق حاضر است که نشانگر افزایش معنی‌دار بیان نسفاتین-1 در اثر فعالیت ورزشی بود.
Chaolu و همکاران که اثر 4هفته رژیم غذای پرچرب و ورزش ارادی را روی موش‌های نر بررسی نمودند، درمجموع اظهار داشتند که رژیم غذایی پرچرب موجب کاهش نسفاتین-1 و آدیپونکتین می‌شود؛ اما این کاهش توسط ورزش سرکوب می‌شود (16). حق‌شناس و همکاران نیز که تأثیر دو نوع شیوه تمرین استقامتی در رت‌های چاق را بررسی نمودند، ثابت کردند که نسفاتین-1 پلاسمایی رت‌های تمرین‌کرده نسبت به گروه کنترل افزایش معنی‌داری داشت (17). نتایج این تحقیق نیز با پژوهش حاضر همسو می‌باشد. توسلی و همکاران نشان دادند که تمرین مقاومتی دایره‌ای در نوجوانان دارای اضافه وزن، منجر به افزایش معنی‌دار نسفاتین-1 و گرلین آسیل‌دار می‌شود که این نتیجه همسو با نتایج تحقیق حاضر است. این محققان اذعان کردند، از آنجا که شدّت فعالیت ورزشی بر هزینه‌کرد انرژی استراحتی و آدیپوکاین‌ها تأثیر دارد و تمرین‌های با شدّت کم و متوسط نسبت به تمرین‌های با شدت بالا، هزینه انرژی تمرینی بالایی دارد، به‌نظر می‌رسد این برنامه تمرین 12هفته‌ای با شدّت پایین که نیازمند هزینه انرژی بیشتری بوده، بر سطح نسفاتین ـ1 تأثیرگذار باشد و تغییرات معنی‌داری را در آن ایجاد نماید. به‌طور خلاصه این پژوهش نشان داد که تمرین منظم و با شدت متوسط، روی سطح نسفاتین-1 پلاسما تأثیر معنی‌داری دارد (18).
در مطالعه دیگری که توسط توفیقی و همکاران انجام گرفت، تغیرات نسفاتین-1 با 8 هفته تمرین استقامتی در مردان جوان چاق بررسی شد. نتایج نشان داد که سطوح سرمی نسفاتین-1 پس از 8 هفته تمرین استقامتی با شدّت پایین تا متوسط، کاهش نیافت (19). در مطالعه دیگری که توسط قنبری نیاکی و همکاران در رابطه با تأثیر یک جلسه تمرین ورزشی شدید بر روی نسفاتین-1 انجام شد، تغییرات نسفاتین-1 در سطح پلاسما مورد بررسی قرار گرفت. در این مطالعه پاسخ دو نوع تمرین بی‌هوازی در ورزشکاران رشته کیک‌بوکسینگ سنجیده شد. این تحقیق نشان داد که یک جلسه تمرین تناوبی بی‌هوازی موجب کاهش نسفاتین-1 پلاسما در آزمودنی‌ها شد؛ اما این کاهش معنی‌دار نبود که از این نظر با تحقیق حاضر مغایرت دارد. البته در دو مرحله خون‌گیری بعدی، افزایش غیرمعنی‌دار نسفاتین-1 پلاسما مشاهده گردید (20). محققان در این کار پژوهشی، کاهش در میزان نسفاتین-1 را به ناشتایی شبانه منتسب کردند و از آنجا که این فاکتور به‌طور اصلی از عامل تغذیه تأثیر می‌پذیرد، چنین کاهشی محتمل به نظر می رسد؛ از طرفی چون در کار پژوهشی حاضر، آزمودنی‌ها فقط دو ساعت قبل از اجرای پروتکل از غذا منع شدند، شاید بتوان آن را دلیلی برای عدم افت بیان نسفاتین-1 دانست.
مجموع این مطالعات که به‌طور عمده در مسیر موافق با تحقیق حاضر است، نشانگر تأثیر ورزش‌های تناوبی، تداومی و یا مقاومتی که اغلب در زمان طولانی‌تری انجام می‌گیرند، بر افزایش بیان ژن و سنتز پروتئین نسفاتین-1 می‌باشد. متأسفانه هنوز مکانیسم‌های درگیر در تغییرات نسفاتین-1 به‌واسطه فعالیت‌های ورزشی تداومی و تناوبی شدید، شناخته شده نیست و با توجه به کم‌بودن تحقیقات ورزشی به‌ویژه در زمینه فعالیت‌های ورزشی حاد و به‌طور ویژه‌تر روی بیان ژن نسفاتین-1، هنوز ناشناخته‌های زیادی پیرامون تأثیر ورزش روی آن وجود دارد. در ادامه در مورد سازوکارهای احتمالی درگیر در اثرگذاری نسفاتین-1 روی اشتها، گلوکز و انسولین و متابولیسم مواد سوختی بحث می‌شود.
تزریق داخل بطنی مغز نسفاتین ـ1 در حیوانات، تا اندازه‌ای مقاومت انسولینی ناشی از رژیم غذایی را از طریق افزایش برداشت عضلانی گلوکز به‌واسطه انسولین، از راه سرکوب تولید گلوکز کبدی، معکوس می‌کند. به‌خوبی شناخته شده است که انسولین، بیان [14]PEPCK و [15]G-6-Pase، دو ژن محدودکننده گلوکونئوژنز را سرکوب می‌کند. بنابراین برای مشخص‌کردن مکانیسم‌هایی که نسفاتین-1 هوموستاز گلوکز را میانجی‌گری می‌کند، مشارکت آن در گلوکونئوژنز از طریق بررسی فعالیت کبدی، mRNA و سطوح پروتئین G-6-Pase و PEPCK ارزیابی شده است. نشان داده شده است که نسفاتین-1 مرکزی منجر به جلوگیری و سرکوب میزان زیادی از mRNA، PEPCK کبدی و سطوح پروتئینی در رت‌ها میشود؛ اما در تغییر فعالیت  G-6-Paseو بیان پروتئین آن ناتوان می‌باشد. نسفاتین مرکزی، با اثرات رژیم چرب روی افزایش بیان ژن PEPCK در محیط In vivo مخالفت می‌کند. همسو با کاهش بیان ژن PEPCK، نسفاتین-1 نیز منجر به کاهش فعالیت آنزیم PEPCK می‌شود که نشانگر تأثیر بیشتر روی PEPCK نسبت به G-6-Pase است (21). بخشی از گلوکز که وارد کبد می‌شود، توسط گلوکوکیناز فسفریله و سپس توسط G-6-Pase دفسفریله می‌شود. G-6-Pase آخرین گام در گلوکونئوژنز و گلیکوژنولیز را کاتالیز می‌کند و PEPCK فقط مسئول گلوکونئوژنز است. نسفاتین-1 مرکزی، منجر به جلوگیری و سرکوب پروتئین PEPCK کبدی و فعالیت آن شده، اما نمی‌تواند فعالیت G-6-Pase را تغییر دهد که نشان می‌دهد شاید PEPCK از G-6-Pase نسبت به وجود کوتاه‌مدت نسفاتین-1 مرکزی حساس‌تر باشد. به علاوه اینگونه در نظر گرفته شده است که سرکوب HGP (تولید کبدی گلوکز) به‌واسطه نسفاتین-1 به ممانعت عبور سوبسترا از G-6-Pase و نه به کاهش در میزان آنزیم G-6-Pase. بستگی دارد؛ بنابراین در رت‌ها، نسفاتین-1 مرکزی می‌تواند تولید گلوکز را اغلب از راه کاهش گلوکونئوژنز و فعالیت PEPCK، کاهش دهد (21).
AMPK[16] یک تنظیم‌کننده کلیدی در متابولیسم چربی و گلوکز است. AMPK به‌عنوان کلید اصلی سوخت‌وساز منتسب شده است؛ زیرا فعالیت آن، با وضعیت انرژی سلول تنظیم می‌شود. نشان داده شد که نسفاتین-1 موجب افزایش فسفریلاسیون AMPK به‌همراه سرکوب زیاد فعالیت، mRNA و سطوح پروتئین PEPCK کبدی در رت‌های با رژیم چرب و معمولی می‌شود. از آنجا که AMPK هوموستاز گلوکز را اغلب از راه سرکوب بیان ژن گلوکونئوژنی و تولید گلوکز کنترل می‌کند (22)، اثر سرکوبی نسفاتین-1 مرکزی روی HGP می‌تواند به‌طور عمده به توانایی آن در جلوگیری از بیان mRNA و پروتئین، PEPCK از طریق فعال‌شدن AMPK، منتسب شود. به علاوه، نشان داده شده است که فعال‌شدن AMPK، جذب گلوکز توسط عضله اسکلتی را افزایش می‌دهد (23، 24)؛ بنابراین افزایش فسفریلاسیون AMPK توسط نسفاتین-1 مرکزی می‌تواند مسئول بهبود مصرف گلوکز در عضله باشد (21).
 
نتیجه‌گیری
سازوکارهای درگیر در تغییرات نسفاتین-1 هنگام فعالیت ورزشی هنوز شناسایی نشده‌اند. در دهه اخیر، نسفاتین-1 به‌عنوان عاملی که هم در اشتها و کاهش وزن و هم در هوموستاز گلوکز دخالت دارد و از این رو هم برای ورزشکاران سطح بالایی که در آرزوی پیروزی در نبرد با چربی‌های اضافی بدنشان هستند و هم برای بیماران دیابتی که درگیری زیادی با انسولین و البته موارد تغذیه‌ای دارند، می‌تواند کاربردهای مناسبی داشته باشد. از آنجا که فاکتور مذکور به تازگی مورد شناسایی و توجه قرار گرفته است، هنوز برای تعیین تأثیرات قطعی آن نیاز به تحقیقات پزشکی و ورزشی بیشتری احساس می‌شود. تحقیق حاضر که اثرگذاری تمرین هوازی حاد بر تغییرات ژنی نسفاتین-1 را بررسی نموده است، نشان داد که فعالیت ورزشی با اولویت تمرینات هوازی، موجب افزایش بیان نسفاتین-1 در آزمودنی‌های دیابتی می‌شود. در مجموعه این تحقیق نیز همانند بسیاری از کارهای پژوهشی دیگر، بر تجویز تمرینات ورزشی برای بیماران دیابتی تأکید می‌کند.
 
تقدیر و تشکر
نویسندگان این مقاله از کلیه عزیزانی که در طول این پژوهش ما را یاری کردند، تقدیر و تشکر می‌نمایند.

منابع:
1- Khalili S, Shekari Khaniani M, Afkhami F, Mansoori Derakhshan S. NUCB2/Nesfatin-1: A Potent Meal Regulatory Hormone and its Role in Diabetes. Egyptian Journal of Medical Human Genetics. 2017; 18(2): 105-9.
2- Oh IS, Shimizu H, Satoh T, Okada S, Adachi S, Inoue K, et al. Identification of nesfatin-1 as a satiety molecule in the hypothalamus. Nature. 2006; 443(7112): 709-12.
3- Aydin S. Multi-functional peptide hormone NUCB2/nesfatin-1. Endocrine. 2013; 44(2): 312-25.
4- Oh-I S, Shimizu H, Satoh T, Okada S, Adachi S, Inoue K, et al. Identification of nesfatin-1 as a satiety molecule in the hypothalamus. Nature. 2006; 443(7112): 709-12.
5- Aydin S. Role of NUCB2/nesfatin-1 as a possible biomarker. Curr Pharm Des. 2013; 19(39): 6986-92.
6- Li QC, Wang HY, Chen X, Guan HZ, Jiang ZY. Fasting plasma levels of nesfatin-1 in patients with type 1 and type 2 diabetes mellitus and the nutrient-related fluctuation of nesfatin-1 level in normal humans. Regul Pept. 2010; 159(1-3): 72-7.
7- Gonzalez R, Tiwari A, Unniappan S. Pancreatic beta cells colocalize insulin and pronesfatin immunoreactivity in rodents. Biochem Biophys Res Commun. 2009; 381(4): 643-8.
8- Ghanbari-Niaki A, Hossein pour F, Fathi R, Daneshpouri M, Akhavan Niaki H, Zarkesh M, et al .Effect of 8 Weeks Endurance Training With Two DifferentDurations on Plasma HDL and Ghrelin in Male Rats. Iran J Endocrinol Metab. 2011;13(2):202-8. [Persian]
9- Salehi I, Mohammad M. Effect of regular swimming on heart oxidative stress indexes and its relation to diabetes in rat. J Arak Univ Med Sci. 2009; 12(3): 67-76. [Persian]
10- Hajihasani A, Bahrpeyma F, Bakhtiari A. Effects of eccentric and concentric exercises on postural sway in type 2 diabetic patients. Koomesh. 2016; 17(2): 493-500. [Persian]
11- WHO. Global Strategyon Diet, Physical Activity and Health: Diabetes. Geneva: World Health Organization; 2006.
12- Su Y, Zhang J, Tang Y, Bi F, Liu JN. The novel function of nesfatin-1: anti-hyperglycemia. Biochem Biophys Res Commun. 2010; 391(1): 1039-42.
13- Bashiri J, Gholami F, Rahbaran A, Tarmahi V. Effect of Single Bout of Aerobic Exercise on Serum Nesfatin-1 Levels in Non-Athlete Elderly Men. Med J Tabriz Univ Med Sci. 2012; 34(4): 25-30. [Persian]
14- Ghanbari Niaki A, Hosseinpour F, Fathi R, Safai-Kenari A. The effect of 8 weeks of endurance training on hypothalamic Nesfatin-1 gene expression and its concentration in male rats. Iran South Med J. 2012; 15(3): 171-82. [Persian]
15- Ghanbari-Niaki A, Rahmati-Ahmadabad S, Ansari-Pirsaraei Z. Effects of Aerobic Training on Tissue Nesfatin-1/Nucleobindin-2 mRNA, Plasma Nesfatin-1 and High-density Lipoprotein Concentration in Female Rats. Iranian Journal of Health and Physical Activity. 2013;4(2):1-7.
16- Chaolu H, Asakawa A, Ushikai M, Li YX, Cheng KC, Li JB, et al. Effect of exercise and high-fat diet on plasma adiponectin and nesfatin levels in mice. Exp Ther Med. 2011; 2(2): 369-73.
17- Hag Shenas R, Ravasi AA , Mohammadreza K. The impact of two twelve-week endurance training method based on weight, food intake, Nesfatin-1 and IL-6 plasma of obese male rats [Dissertation]. [Tehran]: University of Tehran 1391. 1391. [Persian]
18- Tavassoli H, Tofighi A, Hossein panah F, Hedaytai M. Appetite and Exercise Influence of 12 Weeks of Circuit Resistance Training on the Nesfatin-1 to Acylated Ghrelin Ratio of Plasma in Overweight Adolescents. Iran J Endocrinol Metab. 2014; 15(6): 519-26. [Persian]
19- Tofighi A, Mehrabani J, Khadivi SM. The effect of 8 week aerobic exercise on Nesfatin-1 and acylated Ghrelin in young obese men. Medical Journal of Mashhad University of Medical Sciences. 2014; 57(3): 562-70. [Persian]
20- Ghanbari-Niaki A, Kraemer RR, Soltani R. Plasma nesfatin-1 and glucoregulatory hormone responses to two different anaerobic exercise sessions. Eur J Appl Physiol. 2010; 110(4): 863-8.
21- Yang M, Zhang Z, Wang C, Li K, Li S, Boden G, et al. Nesfatin-1 action in the brain increases insulin sensitivity through Akt/AMPK/TORC2 pathway in diet-induced insulin resistance. Diabetes. 2012; 61(8): 1959-68.
22- Stengel A, Goebel M, Wang L, Rivier J, Kobelt P, Mönnikes H, et al. Central nesfatin-1 reduces dark-phase food intake and gastric emptying in rats: differential role of corticotropin-releasing factor2 receptor. Endocrinology. 2009; 150(11): 4911-9.
23- Hardie DG. AMP-activated/SNF1 protein kinases: conserved guardians of cellular energy. Nat Rev Mol Cell Biol. 2007; 8(10): 774-85.
24- Lee YS, Kim WS, Kim KH, Yoon MJ, Cho HJ, Shen Y, et al. Berberine, a natural plant product, activates AMP-activated protein kinase with beneficial metabolic effects in diabetic and insulin-resistant states. Diabetes. 2006; 55(8): 2256-64.
 
[1] Corresponding author; Department of Exercise Physiology of Faculty of Physical Education University Tehran, Tehran, Iran
Tel:02188351730        Fax: 02188021527        Email: m.moradi13@ut.ac.ir
[2] Department of Exercise Physiology of Faculty of Physical Education University of Gilan. Rasht, Iran
[3] Department of Exercise Physiology, Faculty of Sport Sciences, University of Mazandaran, Babolsar, Iran
[4] نویسنده مسؤول؛ گروه فیزیولوژی ورزشی، دانشکده تربیت بدنی، دانشگاه تهران، تهران، ایران
آدرس: تهران- دانشگاه تهران- دانشکده تربیت بدنی و علوم ورزشی- دانشگاه تهران
تلفن: 02188351730       نمابر: 02188021527       پست الکترونیکی: m.moradi13@ut.ac.ir
[5] گروه فیزیولوژی ورزشی، دانشکده تربیت بدنی، دانشگاه گیلان، رشت، ایران
[6] گروه فیزیولوژی ورزشی، دانشکده علوم ورزشی، دانشگاه مازندران، بابلسر، ایران
[7] Nesfatin-1
[8] Nucleobindin-2
[9] Type 1 diabetes mellitus
[10] Type 2 diabetes mellitus
[11] Pilot
[12] Streptozotocin
[13] Intraperitoneal
[14] Phosphoenolpyruvate carboxykinase
[15] Glucose-6-phosphatase
[16] Adenosine monophosphate-activated protein kinase
نوع مطالعه: مقاله اصیل پژوهشی | موضوع مقاله: فیزیولوژی ورزشی
دریافت: ۱۳۹۶/۷/۲۲ | پذیرش: ۱۳۹۷/۲/۳ | انتشار: ۱۳۹۷/۴/۹

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی بیرجند می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2019 All Rights Reserved | Journal of Birjand University of Medical Sciences

Designed & Developed by : Yektaweb