دوره 28، شماره 3 - ( پاییز 1400 )                   جلد 28 شماره 3 صفحات 288-279 | برگشت به فهرست نسخه ها

Research code: ۹۷۰۲۵۷۹۶۵
Ethics code: IR.IAU.SHK.REC.1399.052


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Zandian F, Sazegar H. Comparison of the effect of exercise with Kelussia Odaratissma Mozaff on FoxO1 Expression level in cardiac tissue of obese rats. J Birjand Univ Med Sci. 2021; 28 (3) :279-288
URL: http://journal.bums.ac.ir/article-1-2951-fa.html
زندیان فرزاد، سازگار حسین. مقایسه اثر تمرینات ورزشی با کرفس کوهی بر بیان ژن FoxO1 در بافت قلب موش‌های صحرایی چاق. مجله علمي دانشگاه علوم پزشكي بيرجند. 1400; 28 (3) :288-279

URL: http://journal.bums.ac.ir/article-1-2951-fa.html


1- گروه زیست شناسی، دانشکده علوم پایه، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد، ایران
2- مرکز تحقیقات بیوتکنولوژی، گروه زیست شناسی، دانشکده علوم پایه، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد، ایران ، hoseinsazgar@yahoo.com
واژه‌های کلیدی: ژن FoxO1، بافت قلب، کرفس کوهی، چاقی
متن کامل [PDF 687 kb]   (158 دریافت)     |   چکیده (HTML)  (484 مشاهده)
متن کامل:   (106 مشاهده)
  چکیده
زمینه و هدف: ژن FoxO1 تنظیم‌کننده مهم متابولیسم سلولی در بافت قلب به شمار می­آید. لذا هدف از این تحقیق بررسی اثر عصاره گیاه کرفس کوهی و ورزش بر بیان ژن FoxO1 در بافت عروقی می­باشد.
روش تحقیق: در تحقیق حاضر 30 سر موش صحرایی نر بالغ با وزن 180 تا 200 گرم از نژاد ویستار انتخاب شدند و به پنج گروه کنترل، کنترل منفی، یک گروه موش­های چاق همراه با تمرینات ورزشی (که در 6 هفته چاق شدند و 5 روز در هفته و به مدت یک ساعت تمرین داده شدند و به مدت 6 هفته عصاره داده شد) و دو گروه تیمار با دوز 400 و 800 میلی­گرم/کیلوگرم عصاره کرفس تقسیم شدند. تست­های مولکولی بر روی بافت قلب 30 سر موش با کمک تکنیک Real Time RT PCR انجام شد. در نهایت از نرم­افزار SPSS و آزمون ANOVA برای مقایسه داده‌ها انجام شد. سطح معنی­داری 05/0>P در نظر گرفته شد.
یافته‌ها: عصاره کرفس کوهی با دوز 400 و 800 میلی­گرم/کیلوگرم باعث کاهش چشمگیر بیان ژن FoxO1 به ترتیب (14/0 ± 61/0) و (25/0 ± 70/0) نسبت به گروه چاق شد (05/0>P). همچنین در گروه تمرینات ورزشی نیز بیان ژن FoxO1 کاهش معنی‌داری نسبت به گروه چاق داشت (13/0 ± 54/0). از سوی دیگر نتایج تست­های بیوشیمیایی، کاهش فاکتورهای کلسترول، قند، LDL و تری­گلیسرید را در بافت قلب موش­های چاق در رت­های تیمار شده با دوز 400 و 800 میلی­گرم/کیلوگرم کرفس را نشان داد (05/0>P).
نتیجه‌گیری: تمرینات ورزشی و همچنین عصاره کرفس می­توانند باعث کاهش بیان ژن FoxO1 شود و در صورت تأیید در مطالعات بیشتر می­تواند به عنوان یک هدف درمانی در بیماری قلبی مطرح باشد.
 
مقدمه
بیماری­های قلبی و عروقی به عنوان مهم­ترین عامل مرگ و میر در دنیا محسوب می­شود؛ به طوری­که 60 درصد از موارد مرگ و میر در سال 2000 در جهان را به خود اختصاص داده است و پیش‌بینی می­شود تا سال2020 به 73 درصد برسد (2, 1). علّت اصلی عوارض و مرگ­و­میر در بیماران مبتلا به بیماری­های قلبی و عروقی، پارگی پلاک آترواسکلروتیک و به دنبال آن انفارکتوس میوکارد یا سکته مغزی است. آترواسکلروز نوعی بیماری التهابی مزمن در اثر تجمع چربی است که در نهایت منجر به بروز حاد بیماری قلبی­و عروقی می­شود (4, 3). تقریباً تمام حملات قلبی ناشی از آترواسکلروز عروق کرونری است. آترواسکلروزیس ناشی از رسوب کلسترول LDL و کلسیم در دیواره رگ‌های تغذیه کننده قلب است. بسته به میزان کاهش جریان خون متناسب با نیاز عضله قلبی، آسیب، حمله و یا سکته قلبی رخ می­دهد (6, 5). در برخی افراد که استعداد ژنتیکی به آترواسکلروز دارند یا در افرادی که بیش از اندازه کلسترول و چربی‌های دیگر را مصرف می­کنند، به تدریج مقادیر زیادی کلسترول در زیر اندوتلیوم شریانی بسیاری از مناطق بدن رسوب می­کنند. به تدریج، بافت فیبری به این نواحی رسوب کلسترول حمله می­کند و غالباً نواحی مزبور کلسیفیه می­گردند (8, 7). شواهد تأیید می­کنند که فرآیندهای اپی ژنتیکی مانند متیلاسیون DNA، اصلاح هیستون و RNA های غیر کد کننده نقش مهمی در پیشرفت و آسیب پذیری پلاک بازی می­کنند که با فعال کردن یا حذف این عوامل می­توان بیان ژن را تنظیم کرد. شناخت مکانیسم‌های مولکولی که منجر به تصلب شرایین و بی ثباتی پلاک می­شود، برای توسعه راهکارهای درمانی جدید ضروری است. در ابتدا از پاسخ لایه اندوتلیال به آسیب بافتی شروع می­شود و به دنبال آن لیپیدها در دیواره رگ تجمع می­یابند، در نتیجه التهاب مزمن ایجاد می­شود که می­تواند منجر به پارگی پلاک چربی و ایجاد ترومبوز شود. اخیراً نقش اپی­ژنتیک در تصلب شرایین به طور فزاینده‌ای شناخته شده است (10, 9). FoxO1 (The O subfamily of forkhead) تنظیم کننده مهم متابولیسم سلولی در چندین بافت از جمله قلب وجود دارد که در آن در تنظیمات قلبی مسیرهای متابولیک گلوکز و لیپیدها و اندوتلیوم نقش ایفا می­کند. همچنین نقش مهمی در انرژی هومئوستاز، پاسخ به استرس و اتوفاژی دارد و در دیابت و ایسکمی تنظیم بیان آن دچار اختلال می­شود. فعالیت FoxO1 توسط فرآیندهای پس از ترجمه، مانند فسفوریلاسیون، متیلاسیون، گلیکوزیلاسیون، استیله شدن و یوبیکوینیزه شدن تنظیم می­شود و قادر هستند بر ویژگی­های عملکردی FoxO1 تاثیر بگذارند. شناسایی مارکر­های دخیل در تنظیم بیان  FoxO1 می‌تواند منجر به شناسایی فرآیند­های مربوط به پیشرفت بیماری‌های قلبی و عروقی و روند فعال شدن پلاک مانند مسیر التهاب و تخریب بافت شود. شکل دِاستیله شده FoxO1، در پلاک‌های آترواسکلروتیک انسانی، با کاهش نشانگرهای التهاب و فعال سازی سلولی همراه است (12, 11). پس از ایجاد پزشکی نوین و استفاده گسترده از داروهای شیمیایی گرایش مردم به داروهای گیاهی کاهش یافت؛ امّا بعد از مدتی به علّت شناخت عوارض جانبی دارو­ها و بروز مقاومت دارویی در افراد، داروهای گیاهی به عنوان منبع سالم­تر و بدون عوارض جانبی مورد توجه قرار گرفتند. پس از آن گیاهان همیشه یکی از منابع عمومی داروها بوده­اند که به صورت سنتی یا به شکل فرآورده‌های شیمیایی مورد بهره برداری قرار می‌گیرند (13). گیاه کرفس کوهی با نام علمی  Kelussia odoratissima Mozoffarian از جنس Kelussiae و خانواده چتریان است. این گیاه دو ساله بوده و حداکثر طول آن 155 سانتی متر است. کرفس از جمله گیاهانی است که  به علت وجود فلاونویید در آن خاصیت آنتی اکسیدانی دارد و با این خاصیت از تشکیل رادیکال­های آزاد جلوگیری می­کند. فلاونویید­های موجود در کرفس به فرم اگلیکون هستند و به دلیل شکل فضایی خاص خود جذب روده‌ای سریع و قابل توجهی دارند. مطالعات قبلی نشان داده است که این فلاونویید موجب مهار متابولیسم آراشیدونیک اسید می­شود. همچنین وجود گروه 5-هیدروکسی در ساختار فلاونویید باعث می‌شود که حلقه بتای فلاونویید چرخش آزاد داشته باشد و از این طریق مهار آنزیم 5-لیپو اکسیژناز را تشدید می­کند و التهاب را کاهش می­دهد. کافئیک اسید موجود در این گیاه با داشتن گروه­های O کینول خواص آنتی اکسیدانی دارد و افزایش خواص آنتی اکسیدانی در گروه‌های تحت رژیم کرفس کوهی دیده شده است (16-14).
با توجه به شیوه زندگی امروزه و نوع رژیم غذایی که در جوامع صنعتی به سمت مصرف مواد چرب و فست فودها رفته است و با شناخت اهمیت بیماری تصلب شرایین که در نتیجه این سبک زندگی شیوع قابل توجهی پیدا کرده است و همچنین عوارض جانبی کمتری که داروهای گیاهی نسبت به داروهای شیمیایی دارند، در این مطالعه به بررسی اثر عصاره گیاه کرفس کوهی و ورزش بر بیان ژن FoxO1 در بافت عروقی می­پردازیم.
 
روش تحقیق
نوع مطالعه، گروه‌بندی، چاق کردن و ورزش رت­ها
در این تحقیق روش گردآوری اطلاعات به صورت آزمایشگاهی مشاهده­‌ای بود و 30 سر رت نر بالغ نژاد ویستار با وزن 180 تا 200 گرم از لانه حیوانات دانشگاه علوم پزشکی شهرکرد خریداری شد. حیوانات آزمایشگاهی در شرایط استاندارد 23 تا 25 درجه سانتی­گراد و سیکل 12 ساعت روشنایی و 12 ساعت تاریکی با آب و غذای کافی و استاندارد درون قفس­های مخصوص دانشگاه آزاد اسلامی واحد شهرکرد نگهداری شدند. در ادامه رت‌ها (به استثناء تعداد شش موش به عنوان گروه کنترل) به مدت 6 هفته با چربی بالا که شامل 58% چربی، 25% پروتئین و 17% کربوهیدرات در هر گرم بود چاق شدند. لازم به ذکر است که ابتدا 365 گرم خوراک پودر شده موش را با 10 گرم کلسترول و 250 گرم کازئین و 60 گرم ویتامین-مینرال میکس شده و سپس 3/0 گرم DL متیونین، 1/0 مخمر و 1/0 سدیم کلرید اضافه نموده و در نهایت چربی آب شده با آن میکس شد. سپس به‌وسیله دستگاه پلت زن به صورت خوراک پلت و پرس شده در می‌آوریم و سپس به مدت سه روز در جای خشک و خنک نگهداری شد و آماده مصرف رت­ها شد (17). همچنین برای تمرینات ورزشی از تردمیل مخصوص (با شیب ثابت) موش استفاده شد که موش­ها 5 روز در هفته و به مدت یک ساعت در هر روز بر روی دستگاه قرار گرفتند. گروه‌بندی حیوانات به ترتیب زیر انجام شد:
  • گروه اول را گروه کنترل تشکیل می­دهد که شامل 6 رت با وزن طبیعی (بدون رژیم غذایی پرچرب و فاقد تیمار و تمرینات ورزشی) می­باشد.
  • گروه دوم کنترل منفی (موش­های چاق بدون تیمار و تمرینات ورزشی) است که شامل 6 رت می باشد.
  • گروه سوم را موش­های چاق دریافت کننده دوز 400 میلی­گرم/کیلوگرم عصاره کلوس تشکیل می­دهد.
  • گروه چهارم شامل شش موش­ چاق دریافت کننده دوز 800 میلی­گرم/کیلوگرم عصاره کلوس می­باشد.
  •  گروه پنجم شامل موش­های چاق همراه با تمرینات ورزشی و فاقد تیمار عصاره کلوس می­باشد.
پس از گروه­بندی و طی شدن دوره­ی تطبیق حیوانات با حرارت و رطوبت محل نگهداری، آزمایشات با اعمال رژیم غذایی پرچرب به گروه های مورد مطالعه شروع شد و پس از شش هفته تیمار حیوانات با غذای پرچرب و اطمینان از افزایش وزن موش­ها، تیمار عصاره کلوس و تمرینات ورزشی به مدت شش هفته و بر اساس گروه‌بندی انجام شده اعمال گردید. لازم به ذکر است که رژیم غذایی پرچرب تا پایان آزمایش برای حیوانات مورد مطالعه در نظر گرفته شد. اصول اخلاقی کار با حیوانات آزمایشگاهی در تمام مراحل لحاظ گردید.
 
تهیه عصاره کرفس
گیاه کرفس زیر نظر متخصصین گیاه‌پزشکی دانشگاه آزاد شهرکرد تأیید شده (با عدد هرباریومی 194) و سپس خشک شد. قسمت‌های خشک‌شده توسط آسیاب برقی پودر شد و سپس ۵۰ گرم از این پودر با الکل اتانول ۷۰ درصد صنعتی مخلوط کرده، به‌اندازه‌ای که پودر کامل با الکل پوشیده شود و الکل تا روی گیاه بیاید و بعد از ۵ ساعت از کاغذ صافی عبور داده شد. سپس عصاره‌ای که پس از عبور از کاغذ صافی به دست می‌آید با دستگاه Rotary که روی دمای ۴۰ درجه سانتی‌گراد گذاشته و خود دستگاه شرایط ایده­آل را ایجاد می‌کند، تغلیظ گردید و در نهایت مقدار انتخابی عصاره‌ها با حل کردن آن‌ها در یک حلال مناسب به دست آمد و به صورت گاواژ به رت­ها داده شد (18).

بیهوشی و نمونه‌گیری و استخراج
پس از سی روز نگهداری و انجام گاواژ ، رت­ها با استفاده از کلروفرم بیهوش شدند و نمونه­گیری انجام شد.
قطعه­های کوچک به ابعاد 5/0 در 5/0 سانتیمتر از قلب جدا شد و درون اپندرف 5/1 حاوی یک میلی­لیتر RNA later قرار داده­شد. همچنین نمونه خون نیز گرفته شد. در مرحله بعد RNA با استفاده از کیت یکتا تجهیز آزما (ساخت ایران) استخراج شد و در نهایت بررسی کمی و کیفی آن با استفاده از دستگاه نانودارپ و ژل آگارز یک درصد انجام گردید. سپس با استفاده از کیت یکتا تجهیز آزما cDNA (YT4500) ساخته شد و برای بررسی ژن مورد مطالعه، پرایمرهای مورد استفاده در این پژوهش توسط شرکت سیناژن بر اساس توالی ژن که توسط نرم افزار Primer 3D طراحی شد، سنتز گردید. توالی مورد استفاده در این تحقیق در جدول 1 آورده شده است.
 
 
جدول 1- پرایمرهای مورد استفاده در این پژوهش
سایز دما توالی ژن
 
bp 193
­­­­
C°64
5ˈ- GTCCCTACACAGCAAGTTTATTCG-3 FoxO1-F
5ˈ- TTGCCCGGACTGGAGAGATG -3ˈ FoxO1-R
 
bp 200
­­­­
C°56
5ˈ- TGATTCTACCCACGGCAAGTTC-3ˈ GAPDH-F
5ˈ -CGCTCCTGGAAGATGGTGATG-3ˈ GAPDH-R
 
 
تکنیک RT-PCR
جهت بررسی صحت سنتز cDNA از تکنیک PCR استفاده شد. برای انجام تکنیک PCR، 10 میکرولیتر PCR Master Mix (یکتاتجهیز آزما)، ۵/۰ میکرولیتر از هر کدام از پرایمرهای رفت و برگشت pmol/ μL)۵(، 1 میکرولیتر نمونهcDNA  (ng/ µL ۲۵)، در حجم نهایی 20 میکرولیتر (با آب مقطر استریل) تهیه و مخلوط شد. در ادامه با برنامه دمایی: فعال‌سازی اولیه در دمای ۹۵ درجه سانتی‌گراد به مدت ۵ دقیقه، واسرشت در دمای ۹5 درجه سانتی‌گراد به مدت 30 ثانیه، برای اتصال آغازگرها در دمای مناسب (بهترین دما برای انجام PCR برای ژن­ GAPDH  58 درجه سانتی­گراد بود) به مدت 30 ثانیه، بسط در دمای ۷۲ درجه سانتی‌گراد به مدت 30 ثانیه و طویل­سازی نهایی در دمای ۷۲ درجه سانتی‌گراد و به مدت ۱۰ دقیقه تکثیر انجام شد و در نهایت روی ژل آگارز 1 درصد الکتروفورز انجام گردید.
 
تکنیک Real Time – RTqPCR
در این تحقیق از تکنیک Real Time –RT qPCR (دستگاه Corbett rotor gene 6000) به منظور سنجش کمی سطح بیان ژن­های مورد نظر استفاده شد. برای انجام این تکنیک از SYBR Green (یکتاتجهیز آزما) استفاده شد. لازم به ذکر است که واکنشReal Time –RT qPCR   برای ژن­های مورد نظر و ژن خانه داری به صورت دو تکرار و به همراه یک واکنش کنترل منفی برای هر ژن صورت گرفت. پس از محاسبه  نسبت بیان ژن هدف نسبت به نمونه کنترل با فرمول  محاسبه گردید (21-19).
 
تست‌های بیوشیمیایی
تست­های بیوشیمیایی این پژوهش شامل تست کلسترول، قند، HDL و LDL بود که در ادامه به توضیح آن­ها پرداخته شده است. این آزمایشات با روش اتوآنالیزر و توسط دستگاه اتوآنالیزر (Auto Analyser BT 3000plus، ساخت کشور ایتالیا) انجام شد.
 
 
 
روش تجزیه و تحلیل داده­ها
آنالیز آماری داده­های این تحقیق با استفاده از نرم افزار SPSS نسخه 22 انجام شد. از آن­جا که داده­ها از توزیع نرمال برخوردار بودند، با روش آنالیز واریانس یک طرفه (ANOVA) و با آزمون تعقیبیpost test LSD ارزیابی شدند. تفاوت بین گروه­های مختلف با 05/0>P معنی­دار تلقی شد.
 
ملاحظات اخلاقی
این تحقیق در کمیته اخلاق دانشگاه آزاد شهرکرد با کد IR.IAU.SHK.REC.1399.052 به تصویب رسیده است.
 
یافته‌ها
در جدول 2 وزن موش­ها در 6 هفته ابتدایی مطالعه آورده شده است که نشان دهنده افزایش وزن آن­ها قبل از شروع تیمار عصاره کلوس و تمرینات ورزشی می باشد. همان­طور که در نمودار 1 مشاهده می­شود در گروه کنترل به دلیل عدم استفاده از رژیم پرچرب تغییرات وزنی در طول دوره مورد بررسی ناچیز بوده (19/0P=) درحالی که در موش­های دارای رژیم غذایی پرچرب افزایش قابل توجهی در میانگین وزنی موش­ها پس از 6 هفته ایجاد شده است (001/0P=)؛ بنابراین با توجه به نتایج حاصل از بررسی وزن موش­ها در طول یک دوره 6 هفته­ای پیش از انجام آزمایشات می­توان از افزایش وزن موش­ها و ابتلای آن­ها به چاقی اطمینان حاصل نمود.
 
 
جدول 2- وزن موش­ها در 6 هفته
میانگین وزن هفته اول هفته دوم هفته سوم هفته چهارم هفته پنجم هفته ششم
موش­های کنترل فاقد رژیم پرچرب 9/6 ± 188 2/7 ± 192 1/6 ± 186 7/7 ± 190 3/6 ± 185 7/6 ± 194
موش های دارای رژیم پرچرب 6/7 ± 198 7/8 ± 214 2/10 ± 237 5/9 ± 266 3/10 ± 292 7/12 ± 318
 
 
نمودار 1-بررسی تغییرات وزن موش­های موردد مطالعه در یک دوره 6 هفته­ای
 
نتایج کمی و کیفی مربوط به RNA و صحت سنتز cDNA
در این تحقیق در بررسی کیفی RNAهای استخراج شده مشاهده باندهای  s rRNA 28، s rRNA 18 و s rRNA 8/5 نشان دهنده کیفیت مناسب RNA بود. همچنین نتایج حاصل از الکتروفورز نمونه‌ها پس از RT-PCR با استفاده از پرایمرهای ژن خانه‌داری، که به منظور بررسی صحت سنتز cDNA انجام شد، در تصویر 1 مشاهده می‌شود. همان‌طور که انتظار می‌رفت وجود باند bp 200 نشان دهنده صحت سنتز cDNA از نمونه‌های RNA می‌باشد.
بررسی سنتز ژن FoxO1
به منظور تأیید صحت سنتز FoxO1 با پرایمرهای اختصاصی ژن FoxO1، واکنش RT-PCR انجام شد. پس از پایان کار الکتروفورز محصولات روی ژل آگارز بررسی شد که باند 193 جفت بازی مربوط به FoxO1 دیده شد که در تصویر2 باند ژن نشان داده شده است.
 
تصویر 2- تأیید صحت سنتز ژن FoxO1. چاهک A مارکر، چاهک B کنترل منفی و چاهک C باند 193 جفت بازی ژن FoxO1
 
نتایج آنالیز بیان ژنی
در پژوهش حاضر برای برررسی اثر تمرینات ورزشی و کرفس کوهی بر بیان ژن FoxO1 در بافت قلب موش­های صحرایی چاق داده‌های حاصل از بیان ژن به روش real time RT-PCR با استفاده از آزمون­ آماری T-test independent و سطح معنی‌داری 05/0P< انجام شد.
بررسی نتایج نشان داد که عصاره کرفس کوهی با دوز 400 میلی‌گرم/کیلوگرم می­تواند باعث کاهش چشمگیر بیان ژن FoxO1 (b14/0 ± 61/0) نسبت به دوز 800 در رت­های چاق (ab25/0 ± 70/0) نسبت به گروه چاق شود که این کاهش بیان از نظر آماری معنادار بود (05/0P<). همچنین در گروه موش­ها با تمرینات ورزشی کاهش بیان ژن را نسبت به گروه چاق داشتیم (b13/0 ± 54/0) که در جدول 3 نشان داده شده است.
 
جدول 3- مقایسه میزان تغییرات بیان ژن FoxO1 در گروه‌های مختلف
  
 
گروه چاق سالم عصاره 400 عصاره 800 ورزشی
بیان
ژن
a53/0±14/1 b09/0 ± 39/0 b14/0 ± 61/0 ab25/0 ± 70/0 b13/0 ± 54/0
 


 


نتایج تست­های بیوشیمیایی
تست­های بیوشیمیایی تحقیق حاضر شامل تست کلسترول، قند، HDL و LDL و تری­گلیسرید بود که در ادامه نتایج آن­ها آورده شده است. از سوی دیگر نتایج تست­های بیوشیمیایی کاهش فاکتورها را قلب موش­های چاق در رت­های تیمار شده با دوز  400 میلی­گرم/کیلوگرم کرفس را تأیید کرد.
همان­طور که مشاهده می­شود در نمودار 2 تمام فاکتورها در گروه چاق افزایش داشته و در گروه ورزشی و تیمار با دوز 400 و 800 فاکتورهای کلسترول، قند، LDL و تری­گلیسرید کاهش یافته است. همچنین عصاره کرفس کوهی با دوز 400 میلی‌گرم/کیلوگرم می­تواند باعث کاهش بیشتر بیان ژن FoxO1 نسبت به دوز 800 در رت­های چاق ­شود و این کاهش بیان از نظر آماری نسبت به گروه چاق معنادار بود (05/0P<)
نمودار 2- نتایج تست­های بیوشیمیایی کلسترول، قند، HDL و LDL و تری­گلیسرید در گروه­های تیمار با کرفس، ورزشی، چاق و کنترل. * و ** اختلاف آماری معنی‌دار (P<0.05) دارند.
بحث
با توجه به شیوه زندگی امروزه و نوع رژیم غذایی که در جوامع صنعتی به سمت مصرف مواد چرب و فست فودها رفته است و با شناخت اهمیت بیماری تصلب شرایین که در نتیجه این سبک زندگی شیوع قابل توجهی پیدا کرده است و همچنین عوارض جانبی کمتری که داروهای گیاهی نسبت به داروهای شیمیایی دارند، در این مطالعه بررسی نتایج نشان داد که عصاره کرفس کوهی با دوز 400 میلی­گرم/کیلوگرم می­تواند باعث کاهش چشمگیر بیان ژن FoxO1 نسبت به دوز 800 در رت­های چاق نسبت به گروه چاق شود که این کاهش بیان از نظر آماری معنادار بود همچنین در گروه موش­ها با تمرینات ورزشی کاهش بیان ژن را نسبت به گروه چاق داشتیم. از سوی دیگر نتایج تست­های بیوشیمیایی کاهش فاکتورهای مورد نظر را در رت­های تیمار شده با دوز 400 میلی‌گرم/کیلوگرم کرفس تأیید کرد. در ادامه به بررسی مهم­ترین تحقیقاتی که در این مورد انجام شده است، پرداخته شده است. در سال 2009 رمضانی و همکاران به بررسی اثر ضد التهابی گیاه کرفس پرداختند. جهت ارزیابی التهاب از روش ایجاد تورم در گوش موش توسط گزیلن استفاده شد. موش‌های نر نژاد NMRI  به سه گروه کنترل مثبت دگزا متازون، کنترل منفی و تجربی تقسیم شدند. به موش­های گروه تجربی دوزهای 100، 200، 300، 400 و 500 میلی­گرم بر کیلوگرم عصاره کرفس به صورت درون صفاقی تجویز شد. نتایج نشان داد که اثر ضد التهابی تمامی دوزهای  mg/kg 100 تا 400 عصاره آبی و هگزانی نسبت به کنترل معنی­دار است و نسبت به دگزا متازون اختلاف معنی­داری ندارد و عصاره کرفس وابسته به دوز نیست که این نتایج با نتایج به دست آمده از تحقیق حاضر همسو بود چرا که در این تحقیق نیز دوز بالاتر اثر معناداری بر روی بیان ژن نداشت. عصاره کرفس دارای اثرهای قوی ضد التهابی حتی در دوزهای پایین است که احتمالاً به دلیل وجود فلاونوئید، فتالید و کومارین در دانه کرفس است (22). مینایار و همکاران نشان دادند که کرفس کوهی با اثر گذاشتن بر التهاب روده بزرگ دارای خواص ضد التهابی است (16). Garelnabi و همکارانش نشان دادند که ورزش هوازی و مصرف فلاونوییدها در ترکیب با ورزش توانست سطح تعدیل کننده­های چربی را مانند mRNA PCSK9 تنظیم کنند (23). Wang و همکارانش نشان دادند که مصرف رژیم غذایی پرچرب در موش­های بزرگ آزمایشگاهی نژاد  Sprague–Dawleyآترواسکلروز ایجاد نمود و عصاره گیاه Polygonum capitatum که ماده مؤثر آن از خانواده فلاونوییدهاست توانست پروفایل لیپیدی را در گروه­های بیمار کاهش دهد و بیان فاکتورهای التهابی در بافت کبد را کاهش دهند (24). Burke و همکارانش نشان دادند که ترکیبات دارای فلاونویید می­تواند تأثیر درمانی زیادی در زمینه چاقی، اختلال عملکرد متابولیک و بیماری­های قلبی عروقی داشته باشد (25) که نتایج این تحقیق با نتایج ما همسو است چراکه عصاره کرفس باعث کاهش بیان ژن و به دنبال آن کاهش چاقی خواهد شد. Slopack و همکاران یک جلسه تمرین هوازی بیان ژن FoxO1 را بلافاصله و 2 ساعت ریکاوری را در موش­های صحرایی آزمایشگاهی به میزان معنی­داری افزایش دادند. سطح پروتئین FoxO1 هم تنها 2 ساعت پس از آزمون به میزان معنی­داری افزایش یافت. این اطلاعات اشاره می­کند که بیان ژن FoxO1 در جلسات اولیه یک مداخله تمرینی افزایش می­یابد؛ امّا تمرینات استقامتی طولانی مدت به کاهش سطح پروتئین FoxO1 از جلسات دهم به بعد می­شود. این مفاهیم به کاهش بیان آن در پاسخ به تمرینات استقامتی طولانی مدت اشاره می­کند. از این رو حتی اگر بیان ژن FoxO1 اندازه­گیری نشود این یافته­ها تأکید دارند که تمرینات طولانی مدت به کاهش نقش عملکردی پروتئین FoxO1 منجر می­شود (26). Sanchez و همکاران اظهار داشتند که یک جلسه تمرین استقامتی به افزایش معنی­دار پروتئین و بیان FoxO1 در عضله اسکلتی موش­ها منجر می­شود ؛در حالی که تمرینات استقامتی طولانی مدت به کاهش معنادار بیان FoxO1 منجر خواهد شد. همان­طور که در تحقیق حاضر نیز پس از یک دوره ورزش در موش‌ها کاهش بیان ژن را داشتیم. آن­ها همچنین اظهار داشتند که مهار فعالیت FoxO1 به افزایش ظرفیت اکسایشی عضلات در پاسخ به تمرینات استقامتی منجر می­شود (27). Fouad و همکاران به بررسی بیان FOX و STIP-1  در کارسینومای پاپیلار تیروئید و ارتباط آنها با پیش آگهی بیماران پرداختند. آن­ها اظهار داشتند سطوح بالای بیان FOXE-1 و STIP-1 در PTC با اندازه بزرگتر تومور، گسترش اضافی تیروئید، حمله قلبی، وجود متاستازهای دوردست و مراحل بالاتر سرطان در ارتباط است (28).
 
نتیجه‌گیری
شناسایی مارکر­های دخیل در تنظیم بیان  FoxO1می­تواند منجر به شناسایی فرآیند­های مربوط به پیشرفت بیماری­های قلبی و عروقی و روند فعال شدن پلاک مانند مسیر التهاب و تخریب بافت شود. از طرفی بررسی­ها بر روی کرفس کوهی نشان می­دهد که این گیاه باعث کاهش وزن و همچنین کاهش اختلالات قلبی می­شود و نتایج تحقیق حاضر نشان داد که عصاره کرفس کوهی باعث کاهش بیان ژن FoxO1 در موش­های چاق می­شود و این کاهش بیان از نظر آماری معنادار بود. از سوی دیگر نتایج بر روی موش­های چاق نشان داد که عصاره کرفس کوهی می­تواند به دلیل داشتن فلانوئیدها باعث پیشگیری از بیماری قلبی و لاغری در رت‌های چاق شود و کرفس به دلیل داشتن فلانوئیدها باعث کاهش بیان ژن FoxO1 می­شود و در صورت تأیید در مطالعات بعدی می­تواند به عنوان یک هدف درمانی در بیماری قلبی و چاقی مطرح باشد.
 
تقدیر و تشکّر
این پژوهش برگرفته از پایاننامه کارشناسی ارشد در دانشگاه آزاد اسلامی واحد شهرکرد است و بدین وسیله از تمام افرادی که در انجام این پژوهش یاری رساندند صمیمانه سپاسگزاری می‌شود.
 
تضاد منافع
نویسندگان مقاله اعلام می‌دارند که هیچ گونه تضاد منافعی در پژوهش حاضر وجود ندارد.
 
منابع
1- Vogelmeier CF, Criner GJ, Martinez FJ, Anzueto A, Barnes PJ, Bourbeau J, et al. Global strategy for the diagnosis, management, and prevention of chronic obstructive lung disease 2017 report. GOLD executive summary. Am J Respir Crit Care Med. 2017; 195(5): 557-82. DOI: 10.1164/rccm.201701-0218PP
2- Santilli F, D'Ardes D, Davi G. Oxidative stress in chronic vascular disease: from prediction to prevention. Vascul Pharmacol. 2015; 74: 23-37. DOI: 10.1016/j.vph.2015.09.003
3- Dighe S, Zhao J, Steffen L, Mares J, Meuer SM, Klein BE, et al. Diet patterns and the incidence of age-related macular degeneration in the Atherosclerosis Risk in Communities (ARIC) study. Br J Ophthalmol. 2020; 104(8): 1070-1076. DOI: 10.1136/bjophthalmol-2019-314813
4- Fava C, Montagnana M. Atherosclerosis is an inflammatory disease which lacks a common anti-inflammatory therapy: how human genetics can help to this issue. A narrative review. Front. Pharmacol. 2018; 9: 55. DOI: 10.3389/fphar.2018.00055
5- Förstermann U, Xia N, Li H. Roles of vascular oxidative stress and nitric oxide in the pathogenesis of atherosclerosis. Circ Res. 2017; 120(4): 713-35. DOI: 10.1161/CIRCRESAHA.116.309326
6- Ahotupa M. Oxidized lipoprotein lipids and atherosclerosis. Free Radic Res. 2017; 51(4): 439-47. DOI: 10.1080/10715762.2017.1319944
7- Laclaustra M, Casasnovas JA, Fernández-Ortiz A, Fuster V, León-Latre M, Jiménez-Borreguero LJ, et al. Femoral and carotid subclinical atherosclerosis association with risk factors and coronary calcium: the AWHS study. J Am Coll Cardiol. 2016; 67(11): 1263-74. DOI: 10.1016/j.jacc.2015.12.056
8- Hall JE. Guyton and Hall textbook of medical physiology e-Book: Elsevier Health Sciences; 2010; 1(5): 5-8. Link
9- Xu S, Pelisek J, Jin ZG. Atherosclerosis is an epigenetic disease. Trends Endocrinol Metab. 2018; 29(11): 739-42. DOI: 10.1016/j.tem.2018.04.007
10- Dron JS, Hegele RA. Genetics of triglycerides and the risk of atherosclerosis. Curr Atheroscler Rep. 2017; 19(7): 31. DOI: 10.1007/s11883-017-0667-9
11- Kappel BA, Stöhr R, De Angelis L, Mavilio M, Menghini R, Federici M. Posttranslational modulation of FoxO1 contributes to cardiac remodeling in post-ischemic heart failure. Atherosclerosis. 2016; 249: 148-56. DOI: 10.1016/j.atherosclerosis.2016.04.001
12- Menghini R, Casagrande V, Iuliani G, Rizza S, Mavilio M, Cardellini M, et al. Metabolic aspects of cardiovascular diseases: Is FoxO1 a player or a target?Int J Biochem Cell Biol. 2020; 118: 105659. DOI: 10.1016/j.biocel.2019.105659
13- Jafarzadeh L, Habibian R, Rafieian Kopaei M, Mohammadzade Z. Effect of hydroalcoholic extract of kelussia odoratissima mozaffarian on uterus contractions of mature rats. Horizon Med Sci. 2015; 21(3): 169-74. [Persian] DOI: 10.18869/acadpub.hms.21.3.169
14- Miraj S, Jivad N, Kiani S. A review of chemical components and pharmacological effects of Kelussia odoratissima Mozaff. Der Pharmacia Lettre. 2016; 8(1): 140-7. Link
15- Sedighi M, Rafieian-Kopaei M, Noori-Ahmadabadi M. Kelussia odoratissima Mozaffarian inhibits ileum contractions through voltage dependent and beta adrenergic receptors. Life Sci J. 2012; 9(4): 1033-8. Link
16- Minaiyan M, Sajadi S, Naderi N, Taheri D. Anti-Inflammatory Effect of Kelussia odoratissima Mozaff. hydroalcoholic extract on acetic acid-induced acute colitis in rats. J Rep Pharm Sci. 2014; 3(1): 28-35. Link
17- Kurhe Y, Radhakrishnan M, Gupta D. Ondansetron attenuates depression co-morbid with obesity in obese mice subjected to chronic unpredictable mild stress; an approach using behavioral battery tests. Metab Brain Dis. 2014; 29(3): 701-10. DOI: 10.1007/s11011-014-9574-8
18- Sazegar H, Balali E, Sadeghi Samani F. Effects of Kelussia odoratissima Mozaff Hydroalcoholic Extract on Liver Injury Induced by Carbon Tetrachloride in Mice. J Ilam Univ Med Sci. 2019; 26(5): 30-41. [Persian] DOI: 10.29252/sjimu.26.5.30
19- Vester D, Lagoda A, Hoffmann D, Seitz C, Heldt S, Bettenbrock K, et al. Real-time RT-qPCR assay for the analysis of human influenza A virus transcription and replication dynamics. J Virol Methods. 2010; 168(1-2): 63-71. DOI: 10.1016/j.jviromet.2010.04.017
20- Ferns R, Nastouli E, Garson J. Quantitation of hepatitis delta virus using a single-step internally controlled real-time RT-qPCR and a full-length genomic RNA calibration standard. J Virol Methods. 2012; 179(1): 189-94. DOI: 10.1016/j.jviromet.2011.11.001
21- Ling D, Salvaterra PM. Robust RT-qPCR data normalization: validation and selection of internal reference genes during post-experimental data analysis. PloS one. 2011; 6(3): e17762. DOI: 10.1371/journal.pone.0017762
22- Ramezani M, Nasri S, Yassa N. Study of anti-inflammatory effect of aqueous and hexane extract of Apium graveolens L. in mice. Iranian Journal of Medicinal and Aromatic Plants. 2009; 24(4): 437-43. [Persian] Link
23- Garelnabi M, Mahini H. Role of polyphenolic flavonoid and exercise in atherosclerosis. Free Radic Biol Med. 2018; 128 (1): S26. DOI:10.1016/J.FREERADBIOMED.2018.10.017
24- Wang Z, Jiang X. Flavonoid-rich extract of Polygonum capitatum attenuates high-fat diet–induced atherosclerosis development and inflammatory and oxidative stress in hyperlipidemia rats. Eur J Inflamm. 2018; 16(1): 205-219. DOI: 10.1177/2058739218772710
25- Burke AC, Sutherland BG, Telford DE, Morrow MR, Sawyez CG, Edwards JY, et al. Intervention with citrus flavonoids reverses obesity and improves metabolic syndrome and atherosclerosis in obese Ldlr−/− mice. J Lipid Res. 2018; 59(9): 1714-28.  DOI: 10.1194/jlr.M087387
26- Slopack D, Roudier E, Liu ST, Nwadozi E, Birot O, Haas TL. Forkhead BoxO transcription factors restrain exercise‐induced angiogenesis. J Physiol. 2014; 592(18): 4069-82. DOI: 10.1113/jphysiol.2014.275867
27- Sanchez AM. FoxO transcription factors and endurance training: a role for FoxO1 and FoxO3 in exercise-induced angiogenesis. J Physiol. 2015; 593(Pt 2): 363-4. DOI: 10.1113/jphysiol.2014.285999
28- Fouad EM, Harb OA, Amin SR. The Expression of FOXE-1 and STIP-1 in Papillary Thyroid Carcinoma and Their Relationship with Patient Prognosis. Iran J Pathol. 2018; 13(2): 256-271. Link
 
نوع مطالعه: مقاله اصیل پژوهشی | موضوع مقاله: بيوشيمي
دریافت: 1399/9/20 | پذیرش: 1400/6/24 | انتشار الکترونیک پیش از انتشار نهایی: 1400/6/27 | انتشار الکترونیک: 1400/6/27

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی بیرجند می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2022 CC BY-NC 4.0 | Journal of Birjand University of Medical Sciences

Designed & Developed by : Yektaweb