دوره 25، شماره 4 - ( زمستان 1397 )                   جلد 25 شماره 4 صفحات 297-306 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Hakimi Alni R, Ghobadi N, Najafi Asl M, Sharifi A. Genotyping of Escherichia coli isolated from human and water samples using ERIC-PCR method in Hamadan city. J Birjand Univ Med Sci.. 2018; 25 (4) :297-306
URL: http://journal.bums.ac.ir/article-1-2479-fa.html
حکیمی آلنی رضا، قبادی نواب، نجفی اصل مریم، شریفی آرام. ژنوتایپینگ اشریشیاکلی‌های جداشده از نمونه‌های بیمارستانی و آبی با استفاده از روش ERIC-PCR، در شهرستان همدان. مجله علمي دانشگاه علوم پزشكي بيرجند. 1397; 25 (4) :297-306

URL: http://journal.bums.ac.ir/article-1-2479-fa.html


1- گروه پاتوبیولوژی، دانشکده پیرادامپزشکی، دانشگاه بوعلی سینا، همدان، ایران. ، Reza.hakimi77@yahoo.com
2- گروه کشاورزی (علوم دامی)، دانشگاه پیام نور، تهران، ایران.
3- گروه پاتوبیولوژی، دانشکده پیرادامپزشکی، دانشگاه بوعلی سینا، همدان، ایران.
متن کامل [PDF 651 kb]   (289 دریافت)     |   چکیده (HTML)  (1568 مشاهده)
متن کامل:   (204 مشاهده)
Abstract                                                                                                                                                                        Original Article

Genotyping of Escherichia coli isolated from human and water samples using ERIC-PCR method in Hamadan city

Reza Hakimi Alni[1], Navab Ghobadi[2], Maryam Najafi Asl[3], Aram Sharifi3
 
Background and Aim: Rapid and precise typing of E.coli is a prerequisite for epidemiological surveillance and controlling of infection caused by this bacterium. The present study was conducted to determine the molecular diversity of E.coli strains isolated from human and swimming pools samples using Enterobacterial Repetitive Intergenic Consensus (ERIC) method.
Materials and Methods: This was descriptive-analytic study was conducted, from 2014 to 2016. The target population in this study were 45 isolates of E.coli (25 isolates from human, 20 isolates from swimming pools sample), all of which were confirmed by biochemical and molecular methods. They were then classified using the ERIC-PCR technique.
Results: Generally, in ERIC-PCR product electrophoresis, 3-7 different bands were observed in the range of 100 to 1500 bp. A total of 21 ERIC-PCR profiles were found among all of the studied isolates, that included 12 profiles among human isolates and 10 profiles among swimming pools isolates, and there was one similar profile between them. Based on the results of the dendrogram, 2 main clusters and 7 categories (A to G) were observed.
Conclusion: All isolates were typed using ERIC-PCR and high genetic diversity was observed among the isolates. On the other hand, the presence of common profiles among both sources indicates the possible rotation of these isolates between human-water-humans.
Key Words: Escherichia coli; ERIC-PCR; Human; Pool water
Journal of Birjand University of Medical Sciences. 2018; 25(4): 297-306.
Received: April 17, 2018             Accepted: October 16, 2018
 

مقاله اصیل پژوهشی

ژنوتایپینگ  اشریشیاکلی‌های جداشده از نمونه‌های
 بیمارستانی و آبی با استفاده از روش
ERIC-PCR،
در شهرستان همدان

رضا حکیمی آلنی[4]، نواب قبادی[5]، مریم نجفی اصل[6]، آرام شریفی3
 
چکیده
زمینه و هدف: تایپینگ سریع و دقیق اشریشیاکلی برای اطلاع از اپیدمیولوژی و کنترل بیماری‌های ناشی از آن، امری لازم و ضروری می‌باشد. هدف مطالعه حاضر، تعیین ارتباط ژنتیکی احتمالی در بین جدایه‌های با منابع انسانی و آبی اشریشیاکلی با استفاده از روش Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR بود.
روش تحقیق: این مطالعه توصیفی- تحلیلی، در سال‌های 1393 تا 1395 انجام گرفت. جامعه هدف در این مطالعه، 45 جدایه اشریشیاکلی (25 جدایه بیمارستانی و 20 جدایه از استخر شنای سربسته) بود که همه آنها با استفاده از روش‌های بیوشیمیایی و مولکولی تأیید شدند و در ادامه با تکنیک ERIC-PCR مورد تایپینگ قرار گرفتند.
یافته‌ها: به‌طور کلی در الکتروفورز محصول ERIC-PCR، 3 تا 7 باند مختلف در محدوده کمتر از 100 تا بیشتر از 1500 جفت باز مشاهده گردید. در مجموع 23پروفایل ERIC-PCR در بین ایزوله‌های مورد مطالعه دیده شد که شامل 12 پروفایل در بین جدایه‌های انسانی و 10 پروفایل در بین جدایه‌های آبی بود و همچنین یک پروفایل بین آنها مشترک بود. براساس نتایج دندروگرام، 2 گروه اصلی و 7 دسته (A تا G) مشاهده شد.
نتیجه‌گیری: تمامی جدایه‌های مورد مطالعه با استفاده از روش ERIC-PCR قابل تایپ بودند و همچنین میزان تنوع ژنتیکی بالایی در بین جدایه‌های مورد مطالعه دیده شد. وجود پروفایل مشترک در بین جدایه‌های آبی و انسانی، نشان‌دهنده چرخش احتمالی این جدایه‌ها بین انسان-آب-انسان می‌باشد.
واژه‌های کلیدی: اشریشیاکلی؛ ERIC-PCR؛ انسان؛ آب استخر
مجله علمی دانشگاه علوم پزشکی بیرجند. 1397؛ 25(4): 297-306.
دریافت: 28/01/1397             پذیرش: 24/07/1397
 
مقدمه
اعضای خانواده انتروباکتریاسه، جزء مهمترین باکتریهای بیماریزای انسانی به حساب می‌آیند. اشریشیاکلی، یک باسیل گرم منفی از خانواده انتروباکتریاسه است و به‌عنوان یکی از عوامل اصلی عفونت‌های بیمارستانی و همچنین عفونت مجاری ادراری در انسان می‌باشد (1). عفونت دستگاه ادراری، بعد از عفونت‌های تنفسی شایع‌ترین و و فراوان‌ترین عفونت‌های باکتریایی به حساب می‌آید. باکتری‌های مختلفی ازجمله: استافیلوکوکوس‌ها، کلبسیلا، پروتئوس، انتروباکتر، سودوموناس و ... باعث این نوع عفونت می‌شوند؛ اما اشریشیاکلی رایج‌ترین عامل ایجادکننده عفونت مجاری ادراری است و 80درصد آنها را شامل می‌گردد. این بیماری در هر دو جنس وجود داشته و سنین مختلفی از نوزاد تا افراد سالخورده را درگیر می‌کند (2)؛ از طرف دیگر این باکتری به‌عنوان شاخص آلودگی منابع آبی محسوب شده و وجود آن در آب، به‌عنوان آلودگی مدفوعی آب در نظر گرفته می‌شود (3).
با توجه به گستره وسیع اشریشیاکلی در انسان، حیوانات و محیط، تعیین میزان ارتباط ژنتیکی بین سویه‌های جداشده از منابع مختلف در کنترل بیماری‌های ناشی از آن، اهمیت بالایی دارد. برای دست‌یابی به چنین اهدافی، معمولاً باکتری‌ها را با استفاده از روش‌های فنوتیپی و ژنوتیپی، مورد دسته‌بندی و تایپینگ قرار می‌دهند (4). درگذشته از ویژگی‌های فنوتیپی مانند بیوتیپ و سروتیپ باکتریوفاژ یا باکتریوسین، تیپ و پروفایل حساسیت به آنتی‌بیوتیک، برای تایپینگ باکتری‌ها استفاده می‌شد؛ ولی امروزه با پیشرفت علوم بیولوژی و مولکولی، روش‌های مولکولی ازجمله تایپینگ بر اساس آنالیز توالی ژن‌های خاص، روش‌های تیپ‌بندی بر پایه PCR و تکنیک‌های الکتروفورز برای آنالیز کروموزوم استفاده می‌شود (7- 5). روش‌های تایپینگ مولکولی، انقلابی در مطالعه تنوع سویه‌ها و مطالعه اپیدمیولوژی و نحوه انتشار عفونت در بین مناطق و کشورهای مختلف ایجاد کرده است. این روش‌ها نسبت به روش‌های کلاسیک تیپ‌بندی، از قدرت تمایز و تکرارپذیری خیلی بالایی برخوردار هستند و در حال حاضر، بیشتر از این روش‌ها برای تیپ‌بندی باکتری‌ها ازجمله اشریشیاکلی استفاده می‌شود (8).
یکی از تکنیک‌های مولکولی، روش ERIC-PCR است که اولین‌بار توسط Lupski و همکاران برای تایپینگ میکروارگانیسم‌ها به‌کار برده شد. در این روش، توالی محافظت‌شده تکراری بین ژنی آنتروباکتریایی، برای دسته‌بندی به‌کار برده می‌شود. این توالی‌ها به‌صورت غیرکدکننده و بین ژنی بوده و اندازه آن 126 جفت باز می‌باشد (9). با توجه به اینکه مطابق نظر Versalovic، این توالی‌ها در طول تکامل باکتری برخلاف ژن‌های محافظت‌شده، دچار تغییرات و دگرگونی‌هایی شده‌‌اند و از طرف دیگر، تعداد این توالی‌ها بین جنس، گونه و سویه‌های باکتری متفاوت می‌باشد؛ بنابراین هر ایزوله دارای الگوی باندی متفاوت از دیگران و مختص به خود می‌باشد و این ویژگی به‌عنوان یک هدف مناسب برای تمایز مولکولی جدایه‌های مختلف باکتری‌ها به حساب می‌آید (10).
به‌کارگیری روش‌های تایپینگ برای تیپ‌بندی اشریشیاکلی جداشده از منابع مختلف، در ارتباط‌دهی دقیق بین آن‌ها حائز اهمیت است. اثبات ارتباطات کلون‌های اشریشیاکلی به ما این امکان را می‌دهد که منبع آلودگی را پیدا کرده؛ سویه‌های عفونی را از سویه‌های غیر عفونی متمایز نموده و درنهایت عود را از عفونت مجدد تفکیک نماییم. هدف از مطالعه حاضر، شناسایی تنوع ژنتیکی و بررسی میزان ارتباط ژنتیکی سویه‌های اشریشیاکلی جداشده از منابع انسانی و آبی در شهر همدان بود.
 
روش تحقیق
جمع‌آوری جدایه‌ها:
این پژوهش، یک مطالعه توصیفی- تحلیلی بود که در سال‌های 1394 تا 1395 انجام گردید. جامعه هدف در این مطالعه، 45 جدایه اشریشیاکلی بود که 25 جدایه از بخش میکروبیولوژی بیمارستان شهید بهشتی گرفته شده بود و 20جدایه از نمونه‌های آب استخرهای شهرستان همدان جدا‌سازی شده بود. اگرچه این جدایه‌ها قبلاً به‌عنوان جنس اشریشیاکلی تأیید شده بودند؛ اما برای اطمینان کار، دوباره تمام جدایه‌ها با استفاده از تست‌های بیوشیمیایی (تست اکسیداز، کاتالاز، رنگ‌آمیزی گرم، کشت در محیط TSI، SIM، EMB، اوره‌آز، مک‌کانکی و ...) مورد سنجش قرار گرفتند (11).
استخراج DNA و تأیید مولکولی جدایه‌های اشریشیاکلی:
ابتدا DNA تمام 45 جدایه، با استفاده از روش فنل‌کلروفرم استخراج شد (12). در ادامه از روش PCR برای جستجوی ژن UspA (جهت تأیید ژنوتیپی جدایه‌ها) که قبلاً توسط Chen و همکاران ارائه شده بود، استفاده گردید (13) (جدول 1). واکنش PCR در حجم نهایی 25 میکرولیتر شامل: 5/12 میکرولیتر Master mix (2x.Ampliqon-USA)، 5/0 میکرولیتر از هرکدام از پرایمرها (PM, SinaClon BioScience  25)، 5/2 میکرولیتر DNAی الگو و 9 میکرولیتر آب دیونیزه انجام شد. همچنین برنامه حرارتی برای واکنشPCR  شامل واسرشت ابتدایی در 95درجه سانتیگراد برای مدت 5دقیقه، 32 سیکل تکثیری شامل 92درجه برای یک دقیقه، 70درجه برای 90ثانیه و 72درجه برای مدت 60ثانیه بود و در نهایت تکثیر نهایی در 72درجه سانتی‌گراد برای مدت 8دقیقه اعمال شد. در ادامه محصول PCR در ژل آگارز 2درصد بارگذاری شد.
آزمون ERIC-PCR
برای انجام ERIC-PCR، تمام DNA 45جدایه اشریشیاکلی با استفاده از پرایمرهای ERIC (جدول 1) که قبلاً توسط Versalovic و همکاران (2007) به‌کار برده شده بود، مورد تکثیر قرار گرفتند (10). واکنش PCR در حجم 25میکرولیتر شامل: 5/12میکرولیتر Master mix آمپلیکون، یک میکرولیتر (50 نانوگرم) از DNA الگو، یک میکرولیتر (50 پیکومول) از پرایمر AP-7 و 5/10 میکرولیتر آب مقطر دیونیزه، انجام گرفت. همچنین برنامه حرارتی شامل واسرشت ابتدایی در 95درجه سانتی‌گراد برای مدت 5دقیقه و 32 سیکل تکثیری شامل: 92درجه برای یک دقیقه، 55درجه برای 35ثانیه و 72درجه برای مدت 5/1دقیقه بود و در نهایت تکثیر نهایی در 72درجه سانتی‌گراد برای مدت 8دقیقه اعمال شد. در ادامه محصول PCR در ژل آگارز 2درصد بارگذاری شد.
برای رسم دندروگرام، ابتدا داده‌ها به‌صورت صفر و یک در برنامه Excel ذخیره شد؛ به این صورت که در هر اندازه خاص وجود باند با کد «صفر» و عدم وجود باند با کد «یک» مشخص شد. در ادامه بعد از ارزش‌گذاری نشانگرهای ERIC-PCR به طریقه فوق، داده‌ها وارد نرم‌افزار NTSYS-PC شد و ابتدا ضریب تشابه جاکارد در بین ایزوله‌ها محاسبه شد و گروه‌بندی ژنوتیپ‌ها با استفاده از روش UPGMA انجام گرفت؛ سپس با رسم دندروگرام، میزان تشابه بین ایزوله‌ها نشان داده شد (14).
 
جدول 1- پرایمرهای به‌کار رفته برای انجام PCR
پرایمر توالی الیگونوکلئوتیدی
(5΄- 3΄)
اندازه محصول PCR
(جفت باز)
ERIC-R
ERIC-F
ATGTAAGCTCCTGGGGATTCAC
AAGTAAGTGACTGGGGTGAGCG
150< تا >1500
UspA -R
UspA -F
CCGATACGCTGCCAATCAGT ACGCAGACCGTAGGCCAGAT 884
 
 

سنجش قدرت تمایز:
برای سنجش قدرت تمایز، از معادله Simpon's Index Diversity (معادله 1) استفاده گردید. در این روش، N تعداد کل سویه‌های مورد مطالعه، S تعداد تیپ‌های ژنتیکی به‌دست آمده و nj تعداد سویه‌های متعلّق به تیپ j می‌باشد (15).
معادله (1):
آنالیز نتایج:
درنهایت داده‌ها با استفاده از نرم‌افزار SPSS (ویرایش 19) با روش مربع کای، در حدّ معنی‌داری 05/0>P تجزیه و تحلیل شد.
 
یافته‌ها
شناسایی و تأیید جدایه‌ها:
Description: C:UsersrezaDesktopmmm.jpg
با استفاده از روش‌های کشت و آزمایش‌های بیوشیمیایی، 45جدایه به‌عنوان جنس اشریشیاکلی تأیید شدند. آزمون مولکولی (شناسایی ژن UspA) نیز کاملاً با آزمون‌های بیوشیمیایی منطبق بود و در جستجوی این ژن با استفاده از آزمون PCR، همه جدایه‌ها از این نظر مثبت بودند و در الکتروفورز محصول PCR، باند 884 جفت باز نشان داده شد (شکل 1).
نتایج ERIC-PCR:
 

برای انجام ERIC-PCR، با توجه به اهمیت غلظت DNAی استخراج‌‌شده، ابتدا با استفاده از نانودارپ غلظت DNA تمام جدایه‌ها سنجیده شد. نتایج DNA استخراج‌شده با روش فنل-کلروفرم کیفیت بالایی را نشان داد و در اندازه‌گیری آن با نانودراپ، ng300 تا ng800 در هر میکرولیتر گزارش شد؛ همچنین الکتروفورز 10میکرولیتر از آن در آگارز یک‌درصد، باند شارپ و بدون شکستگی را نشان داد. نتایج حاصل از ERIC -PCR نشان داد که تمامی جدایه‌های مورد مطالعه با استفاده از این روش قابل تایپ بودند؛ به‌طوری‌که 3-8 باند مختلف در محدوده 150< تا >1500 جفت باز ایجاد کردند که در بین آن‌ها باند 180 جفت باز در همه جدایه‌ها دیده شد و باندهای 800 و 900 جفت باز تنها در تعداد محدودی از جدایه‌ها مشاهده گردید. درمجموع 23 پروفایل ERIC-PCR در بین ایزوله‌های مورد مطالعه دیده شد که شامل 12پروفایل در بین جدایه‌های انسانی و 10پروفایل در بین جدایه‌های آبی بود و همچنین یک پروفایل بین آنها مشترک بود.
بر اساس دندروگرام، در میزان تشابه 30درصد، دو گروه اصلی ایجاد شد که با اعداد یونانی I و II نام‌گذاری شدند. ایزوله‌های قرار گرفته در گروه II، شامل هر دو منبع بودند؛ اما در گروه I، تنها جدایه‌های انسانی جای داشتند (شکل 2). از طرفی بر اساس میزان تشابه 70درصد، جدایه‌های مورد مطالعه در 7دسته جای داشتند که در دسته‌های A، B، C، D، E، F و G به‌ترتیب: 8، 4، 3، 3، 2، 16 و 3 جدایه قرار داشتند و بیشترین جدایه‌ها در دسته F قرار گرفته بودند. همچنین، تعدادی از جدایه‌های انسانی و آبی دارای پروفایل ERIC-PCR مشابه و یکسان بودند که در شکل 3 پروفایل آن مشخص گردیده است. این پروفایل در دندروگرام ایجاد شده در گروه II و در دسته F قرار داشت.
شکل 1- الکتروفورز محصول PCR ژن UspA: ستون 1: کنترل مثبت (اشریشیاکلی ATCC25922)؛ ستون 2: جدایه مورد مطالعه؛ ستون 3: کنترل منفی (آب مقطر)؛ ستون L: نردبان ژنی 100 جفت بازی
 
Description: C:UsersrezaDesktopEcoli.45.EMFشکل 2- دندروگرام حاصل از 45جدایه اشریشیاکلی جداشده از نمونه‌های انسانی (H1-H25) و آبی (P1-P20). نام گروه با حروف لاتین (A تا G) مشخص شده است.
 
Description: C:UsersrezaDesktopecolireeza4 copy.jpg

شکل 3- پروفایل حاصل از الکتروفورز محصول REIC-PCR در ژل آگارز یک‌درصد. ستون 1تا 23 مربوط به جدایه‌های اشریشیاکلی؛ ستون L (نردبان ژنی 100 جفت بازی)؛ ستون 3: پروفایل مشترک جدایه‌های انسانی با آبی
 
نتایج بررسی قدرت تمایز و آنالیز داده‌ها:
 بر طبق معادله Simpon's Index Diversity، قدرت تمایز هر روش بین عدد صفر تا یک نشان داده می‌شود؛ به این صورت که هر چه این عدد به یک نزدیک‌تر باشد، نشان‌دهنده قدرت تمایز بالا می‌باشد و هر چه به صفر نزدیکتر باشد، قدرت تمایز آن روش پایین می‌باشد. در این مطالعه قدرت تمایز روش ERIC-PCR، 95/0 بود. همچنین از نظر آماری (05/0>P)، جدایه‌های انسانی و آبی به‌طور معنی‌داری در دو گروه مشخص و جدا از هم قرار گرفته بودند (024/0=P).
 
 
 
بحث
با اینکه تحقیقات زیادی در زمینه تایپینگ مولکولی اشریشیاکلی در سراسر جهان انجام شده است (17، 16 اما مطالعات اندکی به‌صورت همزمان در بین جدایه‌های انسانی و آبی برای بررسی ارتباط دقیق بین آن‌ها در ایران وجود دارد. از این رو در مطالعه حاضر سعی شده است که ارتباط ژنتیکی اشریشیاکلیهای جداشده از انسان و استخر شنا، با استفاده از روش ERIC-PCR نشان داده شود تا احتمال منشأ آلودگی و نحوه توزیع این باکتری در منطقه مشخص گردد.
اگرچه روش‌های مولکولی زیادی برای تیپ‌بندی اشریشیاکلی وجود دارد، اما بسیاری از آنها مانند روش MLST یا PFGE به هزینه بالا و دستگاه‌های گران‌قیمت نیاز دارد؛ اما روش‌های بر پایه PCR مانند روشERIC-PCR از سادگی، سرعت و قدرت تمایز بالا برخوردار بوده و از این‌رو کاربرد وسیعی در تایپینگ باکتری‌ها از جمله آنتروباکتریاسه‌ها دارد (18). در این روش با استفاده از الیگونوکلئوتیدهای تکرارشونده به‌عنوان آغازگر سنتز DNA، برای تایپینگ اشریشیاکلی استفاده می‌شود. برخلاف روش PCR معمولی که برای انجام‌دادن آن نیاز به اطلاعات دقیقی از توالی ژن یا DNAی هدف می‌باشد، در این روش نیازی به این اطلاعات نیست و همین مسئله موجب شده است که کاربری این روش، گسترده و وسیع گردد (19).
در مطالعه Mohapatra و Mazumder (2008) و اردکانی و رنجبر (2016) نشان داده شد که روش ERIC-PCR، به‌عنوان یک ابزار قوی در تایپینگ اشریشیاکلی جداشده از منابع مختلف به حساب می‌آید (16، 20)؛ به طوری که در مطالعه Sekhar و همکاران (2017)، قدرت تمایز این روش 999/0 گزارش شد (21). Chirindze و همکاران (2018) هم نشان دادند که با رعایت شرایط استاندارد در انجام ERIC-PCR، این روش از تکرارپذیری خوبی برخوردار است (17). در مطالعه Dalla-Costa و همکاران (1998)، نشان داده شد که رابطه خوبی بین روش ریبوتایپینگ و ERIC-PCR در تیپ‌بندی اشریشیاکلی وجود دارد و این دو روش می‌توانند به‌عنوان تکنیک‌های خوبی برای بررسی‌های اپیدمیولوژی این باکتری به‌کار برده شوند (22). در مطالعه حاضر نیز روش ERIC-PCR، قدرت تمایز بالایی (95/0) داشت و توانست 45جدایه را در 23تیپ مختلف قرار دهد؛ همچنین در این روش جدایه‌های انسانی و آبی به‌طور معنی‌داری در دو گروه مختلف جای گرفتند که نشان از منشأ مختلف آنها داشت. در واقع این‌طور می‌توان گفت که سویه‌های مشخصی از اشریشیاکلی در محیط آب و بدن انسان وجود دارند که به آن عادت یافته‌اند و خود را با شرایط آن وفق داده‌اند.
در مطالعه حاضر، تعداد الگوهای باندی در هر دو منبع انسانی و آبی بالا بود؛ به‌طوری که 13الگویERIC  در بین 25جدایه انسانی و 11 الگوی ERIC در بین جدایه‌های آبی مشاهده گردید. در این زمینه، در مطالعه Sekhar و همکاران در سال 2017، 134 سویه اشریشیاکلی جداشده از پرندگان، با استفاده از روش ERIC-PCR مورد آنالیز قرار گرفت و نتایج نشان داد که تنوع ژنتیکی بالایی در میان این جدایه‌ها وجود دارد (21). در مطالعه حاضر نیز اگر چه تنوع ژنتیکی در بین جدایه‌های مورد مطالعه بالا بود، اما پروفایل‌های مشترک بین جدایه‌های دو منبع نیز دیده شد. در واقع وجود تنوع ژنتیکی بالا در بین جدایه‌های اشریشیاکلی احتمالاً به‌دلیل انواع جهش‌ها و ژن‌های الحاقی از طریق پلاسمیدهای مختلف باشد که موجب تنوع پروفایل ERIC در بین این جدایه‌ها می‌شود (23، 20). در یک مطالعه دیگر توسط da Silveira و همکاران (2002)، 49جدایه اشریشیاکلی از نمونه‌های مرغ‌های بیمار با 79جدایه از مرغ‌های به ظاهر سالم، با استفاده از تکنینک ERIC-PCR مورد تایپینگ قرار گرفت و در مجموع از 79جدایه مورد تایپینگ‌شده، 68پروفایل ERIC ایجاد شد (23). Durmaz و همکاران (2015) در ترکیه، 42جدایه بالینی اشریشیاکلی را به روش ERIC-PCR تیپ‌بندی کردند که در مجموع 6گروه ایجاد شد که به نتایج مطالعه حاضر نزدیک می‌باشد (24). در مطالعه اردکانی و رنجبر نیز که در سال 2016 انجام گرفت، 96 جدایه اشریشیاکلی بر اساس میزان تشابه 70درصد در 6گروه (E1-E6) جای گرفتند که در مقایسه با مطالعه ما از تنوع پایین‌تری برخوردار بودند (16).
در مطالعه حاضر بر اساس دندروگرام رسم‌شده، در میزان تشابه بالای 70درصد، 7دسته مختلف ایجاد شد که از A تا G نام‌گذاری شدند. بر این اساس، بیشتر سویه‌های جداشده از منابع انسانی در دسته جداگانه‌ای جای داشتند و به عبارتی تفاوت شاخصی بین سویه‌های جداشده از منابع آبی و انسانی دیده شد. با این‌ همه در دسته F (گروه II)، جدایه‌های هر دو منبع انسانی و آبی وجود داشت که نشان از چرخش احتمالی این سویه‌ها و انتقال این جدایه‌ها به انسان از طریق آب داشت. در این مورد Mesa و همکاران (2006)، اشریشیاکلی جداشده از انسان، دام و غذا را با استفاده از روش ERIC-PCR تایپینگ کردند و نشان دادند که اشریشیاکلی می‌تواند از طریق افراد آلوده به این باکتری، به غذا انتقال یافته و در بین افراد جامعه پخش گردد (25). نتایج این مطالعه نیز نشان داد که احتمال آلودگی آب استخر از طریق انسان وجود دارد؛ از طرف دیگر با توجه به تفاوت ژنتیکی بین جدایه‌های انسانی و آبی، می‌توان گفت که یک تمایل ژنتیکی در ایجاد بیماری در بین سویه‌های اشریشیاکلی دیده شد و جدایه‌های ایجادکننده بیماری با جدایه‌های محیطی (آبی) تیپ ژنتیکی متفاوتی داشتند. این مسئله قبلاً در مورد سویه‌های ایجادکننده بیماری در حیوانات هم ذکر شده است؛ به این صورت که تیپ‌های ERIC خاصی از اشریشیاکلی، در پرندگان موجب سپتی‌سمی شده است (23).
در این مطالعه در مجموع 15 کلنی تکی در بین 45جدایه مورد مطالعه مشاهده گردید که نشان از گستره ژنتیکی اشریشیاکلی در منابع مورد مطالعه دارد؛ در واقع می‌توان این جدایه‌ها را به‌عنوان سویه‌های نوظهور قلمداد کرد که در حال حاضر از فراوانی پایینی برخوردار هستند و احتمالاً در آینده این تیپ‌ها در شهرستان همدان از فراوانی بالاتری برخوردار گردند. با این همه، الگوی قرار گرفته در دسته F که مشترک بین منابع انسانی و آبی بود، به‌عنوان الگوی با فراوانی بالا (8 جدایه) در نظر گرفته شد. این الگو را می‌توان به‌عنوان تیپ غالب و اپیدمی در شهر همدان در نظر گرفت؛ هر چند، انجام تحقیقات بیشتر با استفاده از روش‌های مولکولی دیگر مورد نیاز می‌باشد.
 
نتیجه‌گیری
وجود پروفایل مشترک بین منابع انسانی و آبی، حاکی از گردش تعدادی از سویه‌ها بین انسان-آب-انسان می‌باشد. هر چند از نظر تفاوت ژنتیکی بین جدایه‌های آبی و انسانی تفاوت معنی‌داری وجود داشت؛ اما وجود پروفایل مشترک بین این دو منبع نشان می‌دهد که جدایه‌های آبی توان بیماری‌زایی داشته و از نظر بهداشت و سلامت عمومی حائز اهمیت است. همچنین این مطالعه نشان داد که روش ERIC-PCR برای تایپینگ و دسته‌بندی اشریشیاکلی جداشده از منابع آبی و انسانی، قدرت تمایز خوبی داشته و کارآیی بالایی دارد.
 
تقدیر و تشکر
نویسندگان مقاله از مسئولین محترم استخرهای شهر همدان و مسئولین بیمارستان شهید بهشتی (به‌ویژه خانم ملاکیان) برای همکاری در گرفتن نمونه‌ها، نهایت تشکر و سپاس‌گزاری را دارند.
 
تضاد منافع:
نویسندگان این مقاله اعلام می‌دارند که هیچگونه تعارض منافعی در مقاله وجود ندارد.
 
 
 

منابع:
1- Sabir S, Ahmad Anjum A, Ijaz T, Asad Ali M, Ur Rehman Khan M, Nawaz M. Isolation and antibiotic susceptibility of E. coli from urinary tract infections in a tertiary care hospital. Pak J Med Sci. 2014; 30(2): 389-92.
2- Fan NC, Chen HH, Chen CL, Ou LS, Lin TY, Tsai MH, et al. Rise of community-onset urinary tract infection caused by extended-spectrum β-lactamase-producing Escherichia coli in children. J Microbiol Immunol Infect. 2014; 47(5): 399-405.
3- Bain R, Cronk R, Hossain R, Bonjour S, Onda K, Wright J, et al. Global assessment of exposure to faecal contamination through drinking water based on a systematic review. Trop Med Int Health. 2014; 19(8): 917-27.
4- Kolenda R, Burdukiewicz M, Schierack P. A systematic review and meta-analysis of the epidemiology of pathogenic Escherichia coli of calves and the role of calves as reservoirs for human pathogenic E. coli. Front Cell Infect Microbiol. 2015; 5: 23.
5- Rasko DA, Rosovitz MJ, Myers GS, Mongodin EF, Fricke WF, Gajer P, et al. The pangenome structure of Escherichia coli: comparative genomic analysis of E. coli commensal and pathogenic isolates. J Bacteriol. 2008; 190(20): 6881-93.
6- Hakimi Alni R, Mohammadzadeh A, Mahmoodi P. Molecular typing of Staphylococcus aureus of different origins based on the polymorphism of the spa gene: characterization of a novel spa type. 3 Biotech. 2018; 8(1): 58.
7- Shahcheraghi F, Aslani MM, Mahmoudi H, Karimitabar Z, Solgi H, Bahador A, et al. Molecular study of carbapenemase genes in clinical isolates of Enterobacteriaceae resistant to carbapenems and determining their clonal relationship using pulsed-field gel electrophoresis. J Med Microbiol. 2017; 66(5): 570-76.
8- Kiratisin P, Apisarnthanarak A, Laesripa C, Saifon P. Molecular characterization and epidemiology of extended-spectrum-β-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrob Agents Chemother. 2008; 52(8): 2818-24.
9- Lupski JR, Weinstock GM. Short, interspersed repetitive DNA sequences in prokaryotic genomes. J Bacteriol. 1992; 174(14): 4525-9.
10- Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in eubacteria and application to finerpriting of bacterial genomes. Nucleic Acids Res. 1991; 19(24): 6823-31.
11- Murray PR, Rosenthal KS, Pfaller MA. Medical microbiology. 8th ed. Elsevier Health Sciences; 2015.
12- He F. E. coli genomic DNA extraction. 2011. Bio-protocol. Available at: www.bio-protocol.org/e97. Jul 20, 2011.
13- Chen J, Griffiths MW. PCR differentiation of Escherichia coli from other Gramnegative bacteria using primers derived from the nucleotide sequences flanking the gene encoding the universal stress protein. Lett Appl Microbiol. 1998; 27(6): 369-71.
14- James Rohlf F. NTSYS-pc NT. Multivariate Analysis System. Version 2.10 e. New York: Applied Biostatistics. Inc; 2000.
15- Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J Clin Microbiol. 1988; 26(11): 2465-6.
16- Ardakani MA, Ranjbar R. Molecular typing of uropathogenic E. coli strains by the ERIC-PCR method. Electron Physician. 2016; 8(4): 2291-6.
17- Chirindze LM, Zimba TF, Sekyere JO, Govinden U, Chenia HY, Sundsfjord A, et al. Faecal colonization of E. coli and Klebsiella spp. producing extended-spectrum beta-lactamases and plasmid-mediated AmpC in Mozambican university students. BMC Infect Dis. 2018; 18(1): 244
18- Yuan W, Chai TJ, Miao ZM. ERIC-PCR identification of the spread of airborne Escherichia coli in pig houses. Sci Total Environ. 2010; 408(6): 1446-50.
19- Jurkovič D, Križková L, Sojka M, Takáčová M, Dušinský R, Krajčovič J, et al. Genetic diversity of Enterococcus faecium isolated from Bryndza cheese. Int J Food Microbiol. 2007; 116(1): 82-7.
20- Mohapatra B, Mazumder A. Comparative efficacy of five different rep-PCR methods to discriminate Escherichia coli populations in aquatic environments. Water Sci Technol. 2008; 58(3): 537-47.
21- Sekhar MS, Sharif NM, Rao TS, Metta M. Genotyping of virulent Escherichia coli obtained from poultry and poultry farm workers using enterobacterial repetitive intergenic consensus-polymerase chain reaction. Vet World. 2017; 10(11): 1292-6.
22- Dalla-Costa LM, Irino K, Rodrigues J, Rivera IN, Trabulsi L. Characterisation of diarrhoeagenic Escherichia coli clones by ribotyping and ERIC-PCR. J Med Microbiol. 1998; 47(3): 227-34.
23- da Silveira WD, Ferreira A, Lancellotti M, Barbosa IA, Leite DS, de Castro AF, et al. Clonal relationships among avian Escherichia coli isolates determined by enterobacterial repetitive intergenic consensus (ERIC)–PCR. Vet Microbiol. 2002; 89(4): 323-8.
24- Durmaz S, Banu Buyukunal Bal E, Gunaydin M, Yula E, Percin D. Detection of?-lactamase genes, ERIC-PCR typing and phylogenetic groups of ESBL producing quinolone resistant clinical Escherichia coli isolates. Biomedical Research. 2015; 26(1): 43-50.
25- Mesa RJ, Blanc V, Blanch AR, Cortés P, Gonzalez JJ, Lavilla S, et al. Extended-spectrum β-lactamase-producing Enterobacteriaceae in different environments (humans, food, animal farms and sewage). J Antimicrob Chemother. 2006; 58(1): 211-5.
 
[1] Corresponding author; Department of Pathobiology, Faculty of Veterinary Science, Bu-Ali Sina University, Hamedan, Iran.
Tel: +989356023425                                    Email: Reza.hakimi77@yahoo.com, R.hakimi91@basu.ac.ir
[2] Department of Agriculture (Animal science), Payame Noor university, Tehran, Iran.
[3] Department of Pathobiology, Faculty of Veterinary Science, Bu-Ali Sina University, Hamedan, Iran.
[4]  نویسنده مسؤول؛ گروه پاتوبیولوژی، دانشکده پیرادامپزشکی، دانشگاه بوعلی سینا، همدان، ایران.
آدرس:همدان - میدان فلسطین- ابتدای بلوار غبار همدانی- روبروی سازمان انتقال خون استان همدان- دانشکده پیرادامپزشکی  
تلفن: 989356023425+                پست الکترونیکی: Reza.hakimi77@yahoo.com،R.hakimi91@basu.ac.ir
[5]  گروه کشاورزی (علوم دامی)، دانشگاه پیام نور، تهران، ایران.
[6]  گروه پاتوبیولوژی، دانشکده پیرادامپزشکی، دانشگاه بوعلی سینا، همدان، ایران.
نوع مطالعه: مقاله اصیل پژوهشی | موضوع مقاله: ميكروب شناسي
دریافت: ۱۳۹۷/۱/۲۸ | پذیرش: ۱۳۹۷/۷/۲۴

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی بیرجند می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2019 All Rights Reserved | Journal of Birjand University of Medical Sciences

Designed & Developed by : Yektaweb