دوره 23، شماره 1 - ( بهار 1395 )                   جلد 23 شماره 1 صفحات 78-85 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Zandi Dashtebayaz N, Kordi Tamandani D, Naseri M, Anani Sarab G. Mutation spectrum of beta-thalassemia among carriers in Birjand and Amirabad village. J Birjand Univ Med Sci.. 2016; 23 (1) :78-85
URL: http://journal.bums.ac.ir/article-1-2052-fa.html
زندی دشت بیاض نسرین، کردی تمندانی درمحمد، ناصری محسن، عنانی سراب غلامرضا. بررسی جهش‌های شایع بتا تالاسمی در شهرستان بیرجند و روستای امیرآباد. مجله علمي دانشگاه علوم پزشكي بيرجند. 1395; 23 (1) :78-85

URL: http://journal.bums.ac.ir/article-1-2052-fa.html


1- کارشناس ارشد ژنتیک، آزمایشگاه جامع تحقیقات، دانشگاه علوم پزشکی بیرجند، بیرجند، ایران.
2- دانشیار ژنتیک، دانشگاه سیستان و بلوچستان، ایران.
3- استادیار پزشکی ملکولی، مرکز تحقیقات هپاتیت، دانشگاه علوم پزشکی بیرجند، بیرجند، ایران.
4- استادیار هماتولوژی، مرکز تحقیقات ژنومیک، دانشگاه علوم پزشکی بیرجند، بیرجند، ایران ، ghansa@yahoo.com
متن کامل [PDF 297 kb]   (601 دریافت)     |   چکیده (HTML)  (3407 مشاهده)
متن کامل:   (515 مشاهده)

Abstract                                                                                                                                                                        Original Article

Mutation spectrum of beta-thalassemia among carriers in Birjand and Amirabad village

Nasrin Zandi Dashtebayaz[1], Dormohammad Kordi Tamandani[2], Mohsen Naseri[3],

Gholamreza Anani Sarab[4]

Background and Aim: Thalassemia is considered as the most important monogenic disorders around the world. So far, about 60 mutations of this type have been reported in Iranian patients. Comparison between different provinces of the country reveals that the dispersion of the mutations is significantly various with respect to their types and frequencies. The current study aimed at assessing prevalent molecular mutations in β Thalassemia carriers in Birjand  and Amirabad at the suburb of the city.

Materials and Methods: In this descriptive in-vitro study, 34 carriers (15 females and 19 males), who had been identified through marriage screening tests at the health centers in the South Khorasan province were assessed. After obtaining written informed consent of the subjects and completing the respective questionnaires, 2 cc of intravenous blood sample from each subject were collected into EDTA tubes. Salting out and Arms-PCR methods were used for DNA extraction and mutation detection, respectively. Finally, the obtained data was analysed by means of SPSS software (V;19) using Fisher’s test at the significant level of P<0.05).

Results: It was found that among five mutations on 68 chromosomes,  IVS 1-5 mutation with 47.1% frequency was the highest; and the mutations of Codon, Fr 8/9 , IVS II-1 5 , and Codon 37/38/39 had the frequency of 17.6%, 8.8%, 5.9% ,and 5.9% respectively. Out of the mutations, 14.7 % .remained undetermined.

Conclusion: The mutation patterns obtained in Birjand reveal an outstanding difference with the state of affairs in the north and west of IRAN..High frequency of consanguity marriages between thalassemia carrier individuals indicates the potential reason behind increasing the number of patients with major thalassemia.

Key Words: &beta;-Thalassemia, Mutation, Arms-PCR

Journal of Birjand University of Medical Sciences. 2016; 23 (1): 78-85.

Received: February 14, 2016             Accepted: April 25, 2016 

 

مقاله اصیل پژوهشی

بررسی جهش‌های شایع بتا تالاسمی در شهرستان بیرجند و روستای امیرآباد

نسرین زندی دشت بیاض[5]، درمحمد کردی تمندانی[6]، محسن ناصری[7]، غلامرضا عنانی سراب[8]

چکیده

زمینه و هدف: بتا تالاسمی ازجمله مهمترین اختلالات تک‌ژنی در سراسر جهان به‌شمار می‌آید. تاکنون حدود 60 نوع جهش در بیماران ایران گزارش شده است. مقایسه بین استان‌های مختلف کشور نشان می‌دهد که پراکندگی جهش‌ها به‌طور قابل ملاحظه‌ای در نوع و فراوانی متفاوت‌ است. این مطالعه با هدف بررسی مولکولی جهش‌های شایع در ناقلین بتاتالاسمی در شهرستان بیرجند و روستای امیرآباد در حومه بیرجند انجام شد.

روش تحقیق: در این مطالعۀ توصیفی، 34 نفر ناقل تالاسمی (15 مؤنث و 19مذکر) که در طرح غربالگری ازدواج در مرکز بهداشتی شهرستان بیرجند شناسایی شده بودند، بررسی شدند. پس از اخذ رضایت کتبی و تکمیل پرسشنامه، از هر یک از افراد، 2 سی‌سی نمونه خون وریدی همراه با ماده ضد انعقاد  EDTAجمع‌آوری شد. برای استخراج DNA از روش Salting out و برای تعیین جهش‌ها از روش Arms-PCR استفاده شد. در نهایت داده‌ها توسط نرم‌افزار SPSS (ویرایش 19) و با کمک آزمون Fisher، در سطح معنی‌داری 05/0P< تجزیه و تحلیل شد.

یافته‌ها: نتایج حاصل از بررسی پنج جهش شایع بر روی 68 کروموزم نشان داد که جهشIVS I-5  با فراوانی 1/47 درصد دارای بیشترین فراوانی بود و فراوانی هر یک از جهش‌های Codon44، ،Fr 8/9، IVS II-I و Codon 37/38/39 به‌ترتیب: 6/17،8/8، 9/5 و 9/5 درصد به‌دست آمد. همچنین7/14درصد از سایر جهش‌ها بودند که در این مطالعه تعیین نشدند.

نتیجه‌گیری: الگوی جهش‌های به‌دست آمده در بیرجند، اختلاف بارزی با شمال و غرب ایران دارد. زیاد بودن موارد ازدواج‌های فامیلی، حاکی از ظرفیت بالقوّه منطقه به لحاظ افزایش آمار مبتلایان به تالاسمی است.

واژه‌های کلیدی: تالاسمی، جهش، بیرجند، ARMS-PCR

مجله علمی دانشگاه علوم پزشکی بیرجند. 1395؛ دوره 23 (1): 78-85.

دریافت: 25/11/1394                پذیرش: 06/02/1395

 

مقدمه

تالاسمی شایع‌ترین اختلال تک‌ژنی اتوزومال مغلوب در سرتاسر جهان محسوب می‌شود (1). این بیماری، در بیش از 60 کشور جهان و به‌طور عمده در کشورهای خاورمیانه و حوزه مدیترانه شیوع دارد (2). با وجود اینکه بیش از 50 سال از تحقیقات در سطح جهانی برای سندرم تالاسمی می‌گذرد و با وجود پیشرفت‌های غیر قابل انکاری که در شناخت مکانیسم اثر جهش‌های ژنی در بروز علائم بالینی حاصل شده است، هنوز تالاسمی یکی از مشکلات گسترده بهداشتی در جهان به‌شمار می‌رود (3). این بیماری با داشتن بیش از 200 جهش ژنی، تظاهرات متفاوتی از حالت بدون علامت تا بسیار شدید ایجاد می‌کند (1). اکثر این جهش‌ها نقطه‌ای بوده و نه‌تنها نواحی کدکننده اسید آمینه و زنجیره بتا، بلکه نواحی فاقد رمز و حتی داخل اینترون غیر کدکننده را نیز تحت تأثیر قرار می‌دهند (3، 4).

بتاتالاسمی در کشورهای اطراف دریای مدیترانه مانند: یونان، ایتالیا، ترکیه و کشورهای آفریقای شمالی شایع می‌باشد. این بیماری همچنین در عربستان سعودی، پاکستان، ایران، افغانستان، هند و کشورهای آسیای شرقی مانند تایلند و اندونزی شیوع قابل توجهی دارد. بیشترین فراوانی حاملان ژن بتاتالاسمی در قبرس، ساردینیا و آسیای جنوب شرقی گزارش شده است. مهاجرت‌ها و ازدواج بین اقوام مختلف باعث شده است که تالاسمی در اکثر کشورها دیده شود (5، 6). میزان بروز سالانه افراد علامت‌دار حدود یک به صدهزار در سراسر جهان تخمین زده شده است (3). جهش
IVS-I-110 بیشتر در مناطق مدیترانه‌ای و به‌ویژه در جزیره قبرس گزارش شده است (4، 6). همچنین جهش‌های شایع در کشورهای عربی IVS-I-110، IVS-II-1 و در کشور هندوستان جهش IVS-I-5 گزارش شده است (6).

بررسی‌ها نشان می‌دهد که بسیاری از جهش‌های مسؤول ایجاد تالاسمی در ایران را جهش‌های مدیترانه‌ای تشکیل می‌دهد (2). پراکندگی ژن بتاتالاسمی در حاشیه دریای خزر و خلیج فارس و دریای عمان بین 6 تا 10 درصد و در بقیه نقاط ایران بین 1 تا 5 درصد می‌باشد (7، 8). در دو دهه اخیر، جهش‌های ژن بتاگلوبین در چندین استان مورد بررسی قرار گرفته است. ناهمگنی ژنتیکی- قومی در ایران، باعث ظهور انواع متفاومت جهش‌ها، در این ژن شده است. مقایسه بین استان‌های مختلف نشان می‌دهد که پراکندگی ژن‌ها به‌طور قابل ملاحظه‌ای در نوع و فراوانی، متفاوت است. تاکنون حدود 60 نوع جهش مختلف در بیماران ایرانی گزارش شده است (9)؛ از این رو، آشنایی مراکز تشخیصی با جهش‌های ایران و نحوه پراکندگی آنها می‌تواند کمک مؤثّری در تشخیص‌های ژنتیکی در مناطق مختلف ایران باشد (9)

یکی از راه‌های پیشگیری از تولد بیماران مبتلا به تالاسمی، تشخیص قبل از تولد و انجام سقط‌درمانی است. چنانچه از نظر شرعی و قانونی، سن جنین از تاریخ معین نگذشته باشد، مجوز ختم حاملگی توسط پزشکی قانونی صادر می‌شود (4). بر این اساس، لزوم سرعت و دقّت در تشخیص، بسیار حائز اهمیت است. این در حالی است که با توجه به نتایج به‌دست آمده از بررسی‌های مختلف، می‌توان با
به‌کار بردن پرایمرهای اختصاصی جهش‌های شایع شناخته‌شده در مناطق مختلف، کمک شایانی به تسریع تشخیص قبل از تولد (prenatal diagnosis =PND) تالاسمی ماژور کرد. این امر موجب کاهش چشمگیر پرایمرهای مورد استفاده در روند تشخیصی خواهد شد؛
در نتیجه زمینه انجام سریع و ارزان PND را فراهم می‌کند (9، 10).

تعیین اساس مولکولی بتاتالاسمی در همه جای ایران دانش ما را از شیوع جهش‌های نقطه‌ای شایع، جهش‌‌های نادر و نیز حذف‌های ژنی در کشور بهبود خواهد بخشید؛ همچنین شانس شناسایی سریع هتروزیگوت‌های ترکیبی و کیفیت مشاوره‌های ژنتیکی را افزایش خواهد داد (6، 7).

 این بررسی، تلاشی در جهت تسهیل در تشخیص قبل از تولد بیماران تالاسمی شهرستان بیرجند و امیرآباد حومه بود؛ همچنین این مطالعه دارای ارزش اپیدمیولوژیک و آماری است که براساس آن می‌توان جهش‌های شایع در منطقه را شناسایی کرد و مقایسه‌ای با جهش‌های شایع به‌دست آمده در سایر نقاط کشور انجام داد.

روش تحقیق

در این مطالعه توصیفی، 34 نفر ناقل تالاسمی (15 نفر مؤنث و 19 نفر مذکر) شناسایی‌شده درمراکز بهداشتی شهرستان بیرجند در مرکز استان خراسان جنوبی و روستای امیرآباد در حومه بیرجندطی سال 93-1392، وارد مطالعه شدند. جامعه آماری مورد مطالعه شامل مزدوجین ناقل تالاسمی بود که طبق دستورالعمل کشوری، در غربالگری ازدواج در سطح استان خراسان جنوبی در مرکز بهداشت شهرستان بیرجند شناسایی شده و به‌عنوان جمعیت با خطر بالا به لحاظ افزایش آمار مبتلایان به تالاسمی ماژور در سطح استان مطرح بودند.

ابتدا پرسشنامه طراحی‌شده، توسط افراد مورد مطالعه تکمیل گردید. این پرسشنامه حاوی اطلاعات دموگرافیک فرد و بخش رضایت کتبی برای دریافت نمونه خون بود. در مرحله بعد، پس از بررسی پرونده‌های بهداشتی موجود، اطلاعات آزمایشگاهی افراد که شامل: میزان اندکس‌های گلبولی،
MCV (Mean Corposcular Volume
MCH (Mean Corposcular of Hemoglobin) و بررسی میزان هموگلوبین A2 افراد بود، استخراج شد و در ادامه پرسشنامه مربوطه ثبت گردید. بیشتر این آزمایش‌ها برای انجام غربالگری حین ازدواج انجام شده بودند. در پایان نیز جمع‌آوری اطلاعات از طریق انجام بررسی‌های مولکولی بر روی DNA استخراج‌شده به‌روش Arms – PCR صورت گرفت. از روش Arms-PCR به‌منظور مشخص‌کردن جهش‌های نقطه‌ای استفاده شد. پرایمرهای جهش‌یافته و پرایمرهای طبیعی در دو لوله جداگانه مورد بررسی قرار گرفت. پرایمرهای طراحی‌شده، از شرکت زیست‌فناوری کوثر تهیه شدند.

 

 

جدول 1- توالی پرایمرهای استفاده‌شده در این مطالعه

توالی جهش(AWT IMAGE به AWT IMAGE )

نام جهش

AAGAAAACATCAAGGGTCCCATAGACTGAT

IVSII-I M

AAGAAAACATCAAGGGTCCCATAGACTGAC

IVSII-I N

CAGCATCAGGAGTGGACAGATCCCCAATGA

C44 M

AGCATCAGGAGTGGACAGATCCCCAATGG

C44 N

CTCCTTAAACCTGTCTTGTAACCTTGTTAG

IVSI-5 M

CTCCTTAAACCTGTCTTGTAACCTTGTTAC

IVSI-5 N

CCTTGCCCCACAGGGCAGTAACGGCACACC

Fr8-9 M

CCTTGCCCCACAGGGCAGTAACGGCACACT

Fr8-9 N

ACCAGCAGCCTAAGGGTGGGAAAATACACT

IVS I-110M

ACCAGCAGCCTAAGGGTGGGAAAATACACC

IVS I-110N

ACCTCACCCTGTGGAGCCAC

CommonC

GAGTCAAGGCTGAGAGATGCAGGA

BgICF

CAATGTATCATGCCTCTTTGCACC

BgICR

 

از افراد مورد مطالعه، به‌میزان 2 سی‌سی خون وریدی در ویال‌های حاوی ماده ضدّ انعقادK2 -EDTA گرفته شد. نمونه‌ها در حداقل زمان ممکن و تحت شرایط دمایی خاص (دمای 4 تا 8 درجه سانتی‌گراد) به آزمایشگاه مرکز تحقیقات دانشگاه علوم پزشکی بیرجند منتقل شد. استخراج DNA از نمونه‌ها به روش Salting out انجام شد و برای تعیین نوع جهش‌ها از روش ARMS-PCR استفاده گردید. با استفاده از دستگاه نانودراپ، غلظت DNA استخراج‌شده و کیفیّت آن، مورد بررسی قرار گرفت.

برنامه حرارتی مورد استفاده برای تکثیر توالی‌های مورد نظر دربرگیرنده 27 سیکل حرارتی شامل: واسرشته‌سازی در دمای 93 درجه سانتی‌گراد به‌مدت 60 ثانیه، الحاق در دمای 67 درجه سانتی‌گراد به‌مدت 60ثانیه، گسترش در دمای 72 درجه سانتی‌گراد به‌مدت 60ثانیه و گسترش انتهایی در دمای 72 درجه سانتی‌گراد به‌مدّت 2دقیقه بود. در نهایت در این بررسی، از آگاروز یک‌درصد برای تهیه ژل استفاده شد. در مرحله بعد ژل در تانک الکتروفورز قرار گرفت و برای مدت 40 تا 45 دقیقه جریان الکتریکی 85 تا 90 ولت برقرار شد. سپس با قرار دادن ژل در دستگاه ژل‌داک (UVITEC CAMBRIDGE)، از باندهای نمایان‌شده توسط اشعه UV عکس گرفته شد و مورد بررسی و تجزیه و تحلیل مولکولی قرار گرفت.

در نهایت داده‌ها توسط نرم‌افزار SPSS (ویرایش 19) و با کمک آزمون Fisher، مورد تجزیه و تحلیل آماری قرار گرفت. سطح معنی‌داری نیز 05/0P< در نظر گرفته شد.

یافته‌ها

میانگین سنّی در ناقلین تالاسمی مورد مطالعه 9/5±3/29 سال با حداقل سن 17 سال و حداکثر سن 43سال بود. از نظر جنس، 9/55درصد از ناقلین مورد مطالعه مذکر و 1/44 درصد آنها مؤنّث بودند. از نظر وضعیت سکونت نیز 5/73درصد در شهر بیرجند و 5/26درصد در امیرآباد حومه ساکن بودند (جدول 2).

جدول 2- توزیع فراوانی اطلاعات دموگرافیک در مزدوجین ناقل تالاسمی مورد مطالعه

نام متغیر

فراوانی

درصد

محل سکونت

بیرجند

25

5/73

امیرآباد

9

5/26

جنس

زن

15

1/44

مرد

19

9/55

در جدول 3 نیز توزیع فراوانی شرایط خویشاوندی و شرایط عقد در ناقلین تالاسمی شهر بیرجند و امیرآباد حومه ذکر شده است. بر این اساس، به‌میزان 8/58درصد از مزدوجین مورد مطالعه ازدواج فامیلی و 2/41درصد از آنها ازدواج غیر خویشاوندی داشتند. همچنین 3/85درصد از مزدوجین مورد مطالعه، عقد محضری و 7/14درصد آنها عقد شرعی داشتند.

جدول 3- توزیع فراوانی شرایط خویشاوندی، شرایط عقد و وضعیت بالینی در ناقلین تالاسمی مورد مطالعه

متغیّر

فراوانی

درصد

شرایط خویشاوندی

خویشاوند

20

8/58

غیرخویشاوند

14

2/41

نوع عقد

محضری

29

3/85

شرعی

5

7/14

وضعیت بالینی ناقلین

هیچ درمانی نمی‌گیرد

25

5/73

دارو مصرف می‌کند

6

7/17

نامشخص

3

8/8

بر اساس داده‌های جدول چهار، 9/52درصد مزدوجین در حین ازدواج از ناقل‌بودن خود مطلع شدند و 3/38درصد از مزدوجین قبل از ازدواج از ناقل ‌بودن خود مطلع بودند. این در حالی است که 8/8درصد از افراد مورد مطالعه پس از ازدواج از ناقل‌بودن خود آگاهی یافتند. 5/23درصد از ناقلین دارای فرزند مینور و 8/11درصد دارای فرزند ماژور بودند و 6/17درصد فرزندان سالم داشتند (جدول 4).

جدول 4- توزیع فراوانی زمان مطلع‌شدن از ناقل‌بودن و وضعیت زوجین از نظر دارابودن فرزندان سالم و مبتلا به بتاتالاسمی

نام متغیر

فراوانی

درصد

زمان مطلع‌شدن از ناقل‌بودن

قبل از ازدواج

13

3/38

در حین ازدواج

18

9/52

پس از ازدواج

3

8/8

وضعیت فرزندان از نظر تالاسمی

مینور

8

5/23

ماژور

4

8/11

سالم

6

6/17

نامشخص

16

1/47

داده‌ها نشان داد که از میان زوجین ناقل تالاسمی مورد مطالعه، 2/41درصد در مرحله مقدماتی، 8/11درصد در مرحله تکمیلی و 4/29 درصد در هر دو مرحله برای آزمایش‌های تشخیص قبل از تولد مراجعه نموده بودند. از میان افراد واردشده به این مطالعه که وضعیت بالینی آنها مشخص بود، 5/73درصد هیچ درمانی نمی‌گرفتند (جدول 3). نتایج نشان داد میانگین MCV در ناقلین مورد مطالعه 35/4±5/64، MCH 5/1±08/20 و هموگلوبین A2 3/1±7/4 بود.

توزیع فراوانی نوع جهش در بیماران مورد مطالعه، در جدول 5 نمایش داده شده است. جهش‌های
IVS I-5،Codon 44  و Fr 8/9 به‌ترتیب: با فراوانی 1/47، 6/17 و 8/8 از جمله شایع‌ترین موارد جهش بودند (جدول 5).

جدول 5- مقایسه توزیع فراوانی نوع جهش در بیماران مورد مطالعه برحسب جنس

نوع جهش ژنی

جنس

جمع

(درصد) فراوانی

زن

(درصد) فراوانی

مرد

(درصد) فراوانی

IVS I-5

(3/53) 8

(1/42) 8

(1/47) 16

Codon 44

(20) 3

(8/15) 3

(6/17) 6

IVS II-1

(0) 0

(5/10) 2

(9/5) 2

Fr 8/9

(3/13) 2

(3/5) 1

(8/8) 3

Codon 37/38/39

(7/6) 1

(3/5) 1

(9/5) 2

سایر جهش‌ها

(7/6) 1

(0/21) 4

(7/14) 5

جمع

(100) 15

(100) 19

(100) 34

 نمونه‌ای از نتیجه الکتروفورز Arms-PCR در تشخیص جهش IVS I-5 در شکل یک مشاهده می‌شود.

Untitled 

 

شکل 1- تصویر الکتروفورز Arms-PCR در تشخیص IVS I-5 (وجود محصول PCR bp284). ستون یک نشان‌دهنده یک نشانگر DNA، 100bp است. ستون 2 و 3 نمونه فرد مورد مطالعه است. لوله مربوط به حالت نرمال، باند ایجاد کرده ولی لوله مربوط به جهش ایجاد باند نکرده است که بیانگر عدم وجود جهش مورد نظر در این فرد می‌باشد. ستون 4 و 5 نمونه فرد مورد مطالعه است. لوله مربوط به حالت نرمال و جهش‌یافته هر دو ایجاد باند کرده است که بیانگر وجود جهش مورد نظر در این فرد می‌باشد (فرد هتروزیگوت است). ستون 6 و 7، نمونه فرد مورد مطالعه است. لوله مربوط به حالت نرمال ایجاد باند نکرده، ولی لوله مربوط به جهش ایجاد باند کرده است که بیانگر وجود جهش مورد نظر در این فرد به‌صورت هموزیگوت است (فرد هموزیگوت است). ستون 8 و 9 کنترل نرمال است. لوله مربوط به حالت نرمال، ایجاد باند کرده؛ ولی لوله مربوط به جهش ایجاد باند نکرده است. ستون 10 و 11 کنترل منفی است که در هیچ‌کدام از لوله‌ها (M,N )، باندی مشاهده نمی‌شود.

بحث

از تعداد 34 فرد ناقل متأهل مورد مطالعه، 20نفر (8/58%) ازدواج فامیلی داشتند. این موضوع با توجه به افزایش احتمال تولد فرزند هموزیگوت در ازدواج فامیلی، ناظر بر اهمیت برنامه کشوری پیشگیری از بروز تالاسمی ماژور است. وجود 5 مورد (7/14%) عقد شرعی در بین افراد تحت مطالعه، از موارد مهم فرهنگی بالقوّه آسیب‌زننده به کارکرد مطلوب برنامه پیشگیری از بروز موارد جدید تالاسمی در مناطقی مانند خراسان جنوبی می‌تواند باشد. واقعیت تولد فرزند مبتلا به تالاسمی ماژور با فراوانی 8/11% (جدول 4) می‌تواند حاصل همین ازدواج‌های شرعی باشد. همین‌طور عدم اطلاع همه والدین از وضعیت ناقل‌بودن خود قبل از ازدواج و یا وضعیت جنین در رحم مادر از نظر تالاسمی ماژور، از جمله مواردی است که می‌بایستی در جهت جلوگیری از تولد افراد مبتلا به تالاسمی ماژور مورد توجه وسیع‌تری قرار گیرند.

با توجه به قرارگیری کشور ایران بر روی کمربند تالاسمی و کنترل بیماری از طریق ﺑﺮﻧﺎﻣﻪ ﮐﺸﻮری ﭘﯿﺸﮕﯿﺮی از ﺑﺮوز ﺑﺘﺎ ﺗﺎﻻﺳﻤﯽ ﻣﺎژور، لزوم دقّت در اجرای این برنامه و شناخت نقاط آسیب‌پذیر آن بسیار ضروری به نظر می‌رسد. این مسئله به‌ویژه بایستی با توجه به وضعیت فرهنگی و اجتماعی مناطق مختلف کشور، به‌طور پیوسته مورد توجه و مطالعه دست‌اندرکاران و محقّقین در این موضوع قرار گیرد.

در خصوص موتاسیون‌های ژن بتاگلوبولین در 34 ناقل تالاسمی ساکن در شهرستان های بیرجند و امیرآباد حومه، 5نوع موتاسیون در افراد مورد مطالعه مشخص شد. جهش در ناحیه IVS 1-5 و Fr 8/9 هر دو در زمره جهش‌های آسیایی- هندی شناخته می‌شوند. جهش IVS 1-5 در اندونزی، مالزی، برمه و هند و پاکستان به‌ترتیب: با فراوانی 87%، 49%، 29% و 23% گزارش گردید (10، 11). این جهش همچنین در امارات متحده عربی با فراوانی 5/46% گزارش شده است. این الل در پروفایل جهش‌های حاشیه شرقی و جنوبی کشور با فراوانی بین 51% تا 56% به‌عنوان شایع‌ترین آلل گزارش شده است؛ هر چند با حرکت به سمت شمال و غرب کشور از میزان آن کاسته می‌شود (11، 13).

جهش Fr 8,9 (+G) که با اضافه‌شدن نوکلئوتید گوانین بین کدون 8 و 9 ژن بتاگلوبین باعث تغییر غالب خواندن و خاتمه زودرس ترجمه در ژن می‌شود، از جهش‌های شایع در شبه‌قاره هند و پاکستان است (3، 12). این جهش در استان‌های کرمان، خوزستان و سیستان و بلوچستان با فرکانس 15 تا 20 درصد، در ردیف دوم فراوانی آللی قرار دارد. در مطالعه حاضر دومین رتبه مربوط به جهش Codon44 و در حدود 20درصد افراد مورد مطالعه دیده شد. موارد این جهش در اطراف دریای مدیترانه افزایش دارد و در آذربایجان غربی با شیوع 3/9% گزارش شده است (7، 13). فراوانی جهشCodon44  در بین افراد ناقل تالاسمی در بیرجند و امیرآباد حومه، از جمله مواردی است که در این مطالعه دیده شد. در عین حال دست‌یابی به منشأ این جهش و تعیین فرکانس واقعی آن، نیاز به بررسی‌های بیشتر و با حجم نمونه بزرگتری دارد.

نتیجه‌گیری

در مجموع شناسای جهش‌های شایع به‌دست‌آمده در این مطالعه می‌تواند به‌عنوان کاندید مناسبی برای تشخیص‌های ژنتیکی در راستای اهداف برنامه غربالگری تالاسمی در استان خراسان جنوبی باشد. همین‌طور بررسی دقیق موانع و مواضع آسیب‌پذیر در برنامه غربالگری می‌تواند منجر به پیداکردن راه‌حل‌های منطقی و کاهش قابل ملاحظه موارد جدید تالاسمی ماژور در سطح جامعه شود.

تقدیر و تشکر

این مطالعه حاصل قسمتی از طرح تحقیقاتی مصوب معاونت محترم تحقیقات و فناوری دانشگاه علوم پزشکی بیرجند با شماره 911 می‌باشد.

 

منابع:

1- Weatherall DJ. Hemoglobinopathies worldwide: present and future. Curr Mol Med. 2008; 8(7): 592-9.

2- Cao A, Kan YW. The Prevention of Thalassemia. Cold Spring Harb Perspect Med. 2013; 3(2): a011775.

3- Old J, Henderson S. Molecular diagnostics for haemoglobinopathies. Expert Opin Med Diagn. 2010; 4(3): 225-40.

4- Usman M, Moinuddin M, Ghani R, Usman S. Screening of five common beta thalassemia mutations in the Pakistani population: a basis for prenatal diagnosis. Sultan Qaboos Univ Med J. 2009; 9(3): 305-10.

5- Miri-Moghaddam E, Zadeh-Vakili A. Profile of &beta;-thalassemia and its prenatal diagnosis in Khorasan-e-Jonobi Province, Iran. Hemoglobin. 2012; 36(5): 456-63.

6- Rezaee AR, Banoei MM, Khalili E, Houshmand M. Beta-Thalassemia in Iran: new insight into the role of genetic admixture and migration. Scientific World Journal. 2012; 2012: 635183.

7- Saleh-Gohari N, Bazrafshani MR. Distribution of &beta;-Globin Gene Mutations in Thalassemia Minor Population of Kerman Province, Iran. Iran J Public Health. 2010; 39(2): 69-76.

8- Rahimi Z, Muniz A, Akramipour R, Tofieghzadeh F, Mozafari H, Vaisi-Raygani A, et al. Haplotype analysis of beta thalassemia patients in Western Iran. Blood Cells Mol Dis. 2009; 42(2): 140-3.

9- Abolghasemi H, Amid A, Zeinali S, Radfar MH, Eshghi P, Rahiminejad MS, et al. Thalassemia in Iran: epidemiology, prevention, and management. J Pediatr Hematol Oncol 2007; 29(4): 233-8.

10- Najmabadi H, Karimi-Nejad R, Sahebjam S, Pourfarzad F, Teimourian S, Sahebjam F, et al. The beta-thalassemia mutation spectrum in the Iranian population. Hemoglobin. 2001; 25(3): 285-96.

11- Moghadam M, Karimi M, Dehghani SJ, Dehbozorgian J, Montazeri S, Javanmardi E, et al. Effectiveness of &beta;-thalassemia prenatal diagnosis in Southern Iran: a cohort study. Prenat Diagn. 2015; 35(12): 1238-42.

12- Haghi M, Pouladi N, Hosseinpour Feizi M, Hosseinpour Feizi A. Beta-thalassemias in Iran. J Shaheed Sadoughi Univ Med Sci. 2010; 18(2): 127-33. [Persian]

13- Hosseinpour Feizi MA, Hosseinpour Feizi AA, Pouladi N, Haghi M, Azarfam P. Molecular spectrum of &beta;-thalassemia mutations in Northwestern Iran. Hemoglobin. 2008; 32(3): 255-61.

 

 

 

[1] MSc in genetics, Research assistant, Birjand University of Medical Sciences, Birjand, Iran.

[2] Department of Biology, Sistan and Baluchistan University, Zahedan, Iran.

[3] Department of Immunology, Genomic research center, Birjand university of Medical Sciences, Birjand, Iran. 

[4] Corresponding Author; Hepatitis Research Center, Department of Immunology, Birjand University of Medical Sciences, Birjand, Iran.            ghansa@yahoo.com                               Tel: +985632443041-9

[5] کارشناس ارشد ژنتیک، آزمایشگاه جامع تحقیقات، دانشگاه علوم پزشکی بیرجند، بیرجند، ایران.

[6] گروه زیست شناسی، دانشگاه سیستان و بلوچستان، زاهدان، ایران.

[7]  مرکز تحقیقات هپاتیت، گروه ایمونولوژی، رشته پزشکی ملکولی، دانشگاه علوم پزشکی بیرجند، بیرجند، ایران.

[8]  نویسنده مسؤول؛ گروه ایمونولوژی، استادیار هماتولوژی، مرکز تحقیقات ژنومیک، دانشگاه علوم پزشکی بیرجند، بیرجند، ایران

آدرس: بیرجند- خیابان معلم- دانشگاه علوم پزشکی بیرجند- مرکز تحقیقات سلولی و ملکولی

تلفن:05632443041        نمابر: 05632443041       پست الکترونیکی: ghansa@yahoo.com

نوع مطالعه: مقاله اصیل پژوهشی | موضوع مقاله: هماتولوژي
دریافت: ۱۳۹۴/۱۱/۲۵ | پذیرش: ۱۳۹۵/۲/۶ | انتشار: ۱۳۹۵/۲/۱۸

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
کد امنیتی را در کادر بنویسید

ارسال پیام به نویسنده مسئول


کلیه حقوق این وب سایت متعلق به مجله علمی دانشگاه علوم پزشکی بیرجند می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2015 All Rights Reserved | Journal of Birjand University of Medical Sciences

Designed & Developed by : Yektaweb